search for




 

A Study of the Molecular Characteristics of the Serologic D-- Blood Type in Korean Blood Donors
한국인 헌혈자에서 혈청학적 D-- 혈액형의 분자유전학적 특성에 관한 연구
Korean J Blood Transfus 2023;34:92−107
Published online August 31, 2023;  https://doi.org/10.17945/kjbt.2023.34.2.92
© 2023 The Korean Society of Blood Transfusion.

Insoon Jang, M.S., A Hyun Lim, M.S., An Gyo Lee, M.T., Sun-Mi Shin, M.S., Kyoung Won Youn, M.S., Jaehyun Kim, Ph.D., Hwang Min Kim, M.D., Yeongbin Kim, M.D.
장인순ㆍ임아현ㆍ이안교ㆍ신선미ㆍ윤경원ㆍ김재현ㆍ김황민ㆍ김영빈

Blood Transfusion Research Institute, Korean Red Cross, Wonju, Korea
대한적십자사 혈액수혈연구원
Yeongbin Kim, M.D.
Blood Transfusion Research Institute, Korean Red Cross, 50 Hyeoksin-ro, Wonju 26465, Korea
Tel: 82-33-811-0241, Fax: 82-33-811-0240, E-mail: krcmdkyb@redcross.or.kr, ORCID: https://orcid.org/0000-0003-2904-8166
Received April 12, 2023; Revised August 3, 2023; Accepted August 7, 2023.
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
Background:The Korean Red Cross has conducted serologic tests for C, c, E, e antigens and found 18 D-- donors. In this study, we performed RHCE genotyping to identify the molecular characteristics of the serologic D-- blood type in Korean blood donors.
Methods:We performed RHCE-specific PCR-based electrophoresis to check the amplification pattern of each exon. Sanger sequencing was conducted to find the variants in the nucleotide sequence. We determined the RHCE genotype based on the electrophoresis and Sanger sequencing results.
Results:Total eight out of 18 D-- donors were participated in this research. In the PCR-based electrophoresis tests, RHCE exons 3, 4, and 6 were not amplified in samples #4, #6, and #8. Also, sample #2 showed an abnormal band pattern of RHCE exon 9. The Sanger sequencing results showed that the nucleotide sequences of the RHCE exons 5, 7, and 8 in samples #4, #6 and #8 corresponded to the nucleotide sequences of RHD exons 5, 7, and 8, respectively, suggesting the possibility of a RHCE-RHD(3-8)-RHCE hybrid allele. The nucleotide sequences of RHCE exons 7 and 8 in sample #2 were the same as the nucleotide sequences of RHD exons 7 and 8, respectively. In samples #1, #3, #5, and #7, no specific variants known to cause D-- phenotype were found.
Conclusion:RHCE genes partially replaced by the RHD genes were found in four out of eight participants and three of them were identified as RHCE*02N.07, which is known as the RHCE null allele. A further study with complete RHCE sequencing could be helpful for an understanding of the molecular mechanisms of samples in which no significant variants were identified.
Keywords : D--, RHCE genotyping, Rare blood
서론

Rh 혈액형군은 사람 적혈구에서 가장 복잡한 혈액형 항원군으로, 이에 속하는 적혈구 항원으로는 D, C, c, E, e 항원을 비롯해 현재까지 55종 이상이 알려져 있다[1]. 적혈구 표면의 Rh 면역복합체는 RhD 1분자, RhCE 1분자 및 RhAG 2분자로 구성되어 있으며, RhD 단백 분자에는 Rh 혈액형군 항원 중 가장 면역원성이 강한 D 항원이 존재하고, RhCE 단백 분자에는 C, c, E, e 항원이 존재한다. 그런데 RHCE 유전자 산물의 결핍으로 인하여 C, e, E, e 항원이 모두 발현되지 않아 적혈구 표면에 D 항원만 강하게 발현되는 경우가 매우 드물게 발생하며, 이러한 혈액형을 D-- (D dash dash) 혈액형이라고 한다[2]. D-- 혈액형을 가진 사람이 임신이나 수혈에 의해 감작되는 경우 대부분의 사람에게 존재하는 CcEe 항원복합체에 대해 반응하는 anti-Rh17 (anti-Hr0) 항체가 형성될 수 있으며, 이 항체가 발생하면 동일한 D-- 형이 아닌 혈액을 수혈할 경우 항원-항체 간 반응에 의해 심각한 용혈 현상이 발생할 수 있다[2].

D-- 혈액형은 극도로 희귀하기 때문에 해당 혈액이 필요한 시점에 무작위로 일반 헌혈자의 혈액제제를 추출하여 혈액형 검사를 시행하는 것으로는 적시에 혈액을 확보하기가 매우 어렵다. 이에 여러 선진혈액사업국가에서는 사전에 헌혈자에게 혈액형 선별검사를 시행한 결과를 바탕으로 D-- 형 헌혈자를 발굴하여 등록헌혈자로 관리함으로써 D-- 형 혈액을 확보하고 있다[3].

우리나라에서도 2004년 및 2017년 두 차례에 걸쳐 D-- 혈액형을 가진 환자에게 수혈이 필요한 사례가 발생하였으나 국내에서는 해당 혈액을 확보할 수 없어 일본적십자사로부터 D-- 혈액제제를 공급받아 수혈한 사례가 있으며, 또한 2015년에는 냉동 보관 중이던 자가 적혈구제제를 해동하여 수혈한 D-- 환자의 사례가 보고되었다[4]. 이러한 경험으로 인해 국내에서도 D-- 헌혈자를 적극적으로 발굴하여 등록헌혈자로 관리해야 할 필요성이 지속적으로 제기되어 왔다[5].

이에 따라 대한적십자사에서는 헌혈자에게 시행하는 Rh 혈액형 선별검사 대상을 C, c, E, e 항원 모두로 확대하였으며, 2018년 6월부터는 자동화장비를 사용한 선별검사에서 C, c, E, e 항원이 모두 음성(–)으로 나타날 경우 항혈청 시약을 사용하여 수기로 혈액형 확인검사를 실시해 C, c, E, e 항원의 표현형이 실제 음성인지를 검증하였다. 이러한 과정을 거쳐 2021년까지 총 18명의 헌혈자가 혈청학적 D-- 형으로 확인되었으며, 이를 등록헌혈자로 별도 관리하고 있다[5]. 이에 2020년 수혈이 필요한 D-- 혈액형의 림프종 환자가 발생하였을 때에는 2004년 및 2017년과는 달리 국내의 D-- 등록헌혈자를 활용하여 적혈구 및 혈소판 제제를 공급하는 성과를 거둘 수 있었다[6].

그런데 이는 혈청학적 검사를 통해 D-- 혈액형임을 확인한 것으로, 유전학적 혈액형 검사는 시행되지 않았다. 따라서 해당 헌혈자들이 유전학적으로도 RHCE 유전자 산물이 결핍되어 C, c, E, e 항원이 실제로 전혀 발현되지 않는 진성(true) D-- 혈액형인지 여부를 확인하여야 할 필요성이 있었다. 또한 한국인 D-- 형에서 RHCE 유전자 산물의 결핍을 초래한 분자유전학적 기전이 무엇인지에 대해 그간 알려진 바가 없는 상황이었다. 이에 본 연구에서는 혈청학적 검사에서 D-- 혈액형으로 확인된 헌혈자를 대상으로 RHCE 유전자 분석 검사를 시행하여 국내 D-- 혈액형의 분자유전학적 특성을 확인하고자 하였다.

대상 및 방법

본 연구는 대한적십자사 혈액관리본부 생명윤리심의위원회의 승인을 받아 진행하였다(IRB no. 21-4차-정-6).

1.대상

먼저 RHCE 유전자 검사법을 정립하고 검증하는 과정에는 혈액수혈연구원에서 상용화된 ID COREXT (Progenika Biopharama-Grifols, Bizkaia, Spain) 검사시스템을 사용하여 유전학적 혈액형 분석을 진행하였던 기존 연구 모집 검체 중 헌혈자가 지정한 보존기간 내에 있고 타 연관연구에 검체를 제공하는 것에 동의한 연구참여자의 냉동 보관검체 20개를 사용하였으며, C, c, E, e 각 항원이 양성이거나 음성인 검체가 골고루 포함되도록 검체를 선정하였다.

다음으로, 2021년까지 대한적십자사 혈액검사센터에서 PK7300 및 PK7400 자동 혈구응집 검사장비(Beckman Coulter, Brea, CA, USA)를 사용하여 시행한 Rh 혈액형 선별검사에서 C, c, E, e 항원 음성 결과를 보여, 항혈청 시약을 사용한 수기 확인검사를 시행한 결과에서도 C, c, E, e 항원이 모두 음성으로 확인된 헌혈자 18명을 대상으로 자발적 의사에 따라 연구참여에 대해 동의를 구하고 연구참여자를 모집하였다. 그 결과 총 8명이 연구에 참여하였으며, 이들에게 연구참여 동의서, 인체유래물 연구동의서 및 개인정보 제공 서식을 확보하고 EDTA tube에 정맥혈 검체를 채취하였다.

2.방법

1)혈청학적 RhCcEe typing

모집된 8명의 D-- 헌혈자 EDTA 정맥혈 검체에 대해 anti-D (SIHDIA, Shinyang Diagnostics, Seoul, Korea), anti-C, anti-c, anti-E, anti-e (이상 DIAGAST, Loos, France) 항혈청시약을 사용하여 표준 tube법으로 혈청학적 검사를 실시하고 실온, 37℃, anti-human globulin (AHG) 반응조건에서 응집 여부를 확인하였다.

2)DNA 추출

SLA-D14800 (TANBead, Taoyuan, Taiwan) 장비와 TANBead Nucleic Acid Extraction Kit (TANBead, Tao-yuan, Taiwan)를 사용하여 희귀혈액 연구 EDTA 전혈 냉동 보관검체 20개와 D-- 헌혈자 8명의 EDTA 전혈검체에서 DNA를 추출하였다. 추출된 핵산의 농도 및 순도 검증에는 NanoDrop (ThermoFisher Scienti-fic, Waltham, MA, USA)을 사용하였다.

3)RHCE genotyping

본 연구에서는 타 연구자의 기존 보고에서 소개되었던 검사법[7]을 바탕으로 exon 5, 6, 8에 대한 second (nested) PCR을 추가하여 RHCE genotyping을 시행하였다.

(1)polymerase chain reaction with sequence specific primers (PCR-SSP) 및 전기영동

RHCE 유전자의 10개 엑손 및 인접 인트론 부위를 선택적으로 증폭할 수 있는 primer를 사용하여 PCR을 시행하였다(Table 1). 내부대조(internal control)를 위해 인간성장호르몬(human growth hormone, HGH) 위치에 대한 PCR을 함께 시행하였다. DNA, AmpliTaq Gold 360 Master Mix (App-lied Biosystems, Foster City, CA, USA), 360 GC enhancer (Applied Biosystems)와 primer set를 혼합하여 총 부피를 25 μL로 만든 후 Verti 96 well Thermal Cycler (Applied Biosystems) 장비를 사용하여 PCR을 시행하였다. 95℃에서 10분간 pre-denaturation하고 이후 35 cycle 동안 primer set 종류에 맞추어 95℃ denaturation 30초, 58℃/60℃ annealing 30초, 70℃ extension 30초/1분의 과정을 반복하였으며, 이후 72℃에서 7분간 final extension을 진행하였다. 엑손 5, 6, 8의 경우 RHCERHD 유전자의 상동성에 따른 증폭 오류를 방지하기 위해 먼저 RHCE specific primer를 사용하여 엑손 5∼6 및 엑손 8에 대한 1st PCR을 시행하였으며, 전기영동에 적절한 증폭산물 크기를 감안한 별도의 primer를 적용해 2nd PCR을 시행하여 엑손 5, 6, 8 각각에 대해 증폭산물을 획득하였다. 증폭 산물은 LabChip GX (Caliper Life Sciences, Hopkinton, MA, USA) 장비로 microfluidic capillary electrophoresis를 진행하여 각 엑손 별 증폭 여부 및 증폭산물의 크기를 확인하였다.

Polymerase chain reactions (PCR) primers for sequence-specific PCR

Target region Primer Sequence (5’→3’) Binding site RHCE specific Annealing temp. Extension time
5’ UTR to exon 1 F gaactaagtcccaagccccg 5’ UTR Yes 58℃ 30 s
Exon 2 F gcagatggtgtggtagtcc Intron 1 Yes 58℃ 30 s
R ggggtccattccctctatg Intron 2 No
Exon 3 F taaggctagtgtcttttcagg Intron 2 Yes 60℃ 30 s
R ccaggttcatctctaactc Intron 3 Yes
Exon 4 F ctctgaacaccagtctcg Intron 3 Yes 58℃ 30 s
R ctgcccgattttctattagcctc Intron 4 Yes
Exon 5-6 (1st) F aggctaatagaaaatcgggcag Intron 4 Yes 60℃ 1 min
R ttgaagccaataagagaatgca Intron 6 Yes
Exon 5 (2nd) F aaatgtggttagctggtatcag Intron 4 No 58℃ 30 s
R tgtgtgctagtcctgttagacc Intron 5 No
Exon 6 (2nd) F gcagcaagatggtgttctct Intron 5 No 58℃ 30 s
R ttgaagccaataagagaatgca Intron 6 Yes
Exon 7 F ccatttggtggcgccggat Intron 6 Yes 60℃ 30 s
R ctgctctgtgtttgtgggg Intron 7 Yes
Exon 8 (1st) F ggttgccttgaaggagagaga Intron 7 Yes 58℃ 30 s
R ctgggattacaggtgccc Intron 8 Yes
Exon 8 (2nd) F gcccttcctggcaatggca Intron 7 No 58℃ 30 s
R cacacggcagggtgcgct Intron 8 No
Exon 9 F ggtccaggaatgacagggcg Intron 8 Yes 60℃ 30 s
R caggcatgtgctaccacg Intron 9 Yes
Exon 10 F caagagatcaagccaaaatcagt Intron 9 Yes 58℃ 30 s
R ggaatgccagccaccttgtaaa 3’ UTR Yes
Human growth hormon (internal control) F tgccttcccaaccattccctta - 58℃ 30 s
R ccactcacggatttctgttgtgtttc -

(2)Sanger sequencing

전기영동에서 각 RHCE 엑손의 PCR 증폭이 확인된 경우에는 증폭산물에 대해 Sanger sequencing을 진행하여 해당 엑손 및 인접 인트론 부위의 염기서열을 확인하였다. PCR 증폭산물 10 μL에 ExoSAP-IT (Applied Biosystems) 4 μL를 혼합하여 37℃에서 15분간 반응시킨 후 80℃에서 15분간 불활화하고 PCR 산물을 세척하였다. Sequencing PCR에는 BigDye Terminator v3.1 Cycle Sequen-cing Kit (Applied Biosystems)를 사용하였으며 PCR 증폭산물 2 μL와 Reaction Mix 4 μL, primer 2 μL를 넣고 총 부피가 10 μL가 되도록 하여 Cycle sequencing을 실시하였다. 각 엑손 별 primer와 검사조건은 Table 2와 같으며, 96℃에서 1분간 pre-denaturation 한 후 96℃ 10초 denaturation, 50℃ 5초 annealing, 60℃ 4분 extension의 과정을 35회 반복하였다. 결과물을 BigDye XTerminator Purification Kit (Applied Biosystems)를 사용하여 정제한 후 3500 DX Genetic Analyzer (ThermoFisher Scienti-fic, Waltham, MA, USA) 장비에서 POP7 polymer (Applied Biosystems)를 사용하여 Sanger sequencing을 진행하였다. 염기서열 판독에는 Sequencher 5.4 (Gene Codes Corp., Ann Arbor, MI, USA) 프로그램을 이용하였으며, 변이 존재 여부 확인을 위한 RHCE 유전자의 기준 염기서열로는 NM_020485. 8 및 NC_000001.11을 사용하였다.

Primer sequences for Sanger sequencing

Target region Primer Sequence (5’→3’) Binding site RHCE specific Amplicon size (bp)
5’ UTR to exon 1 F gaactaagtcccaagccccg 5’ UTR (–836 to –817)** Yes 1146
Exon 2 F tccagctgccatttagtaagactc Intron 1 (–92 to –69) No 330
R ggggtccattccctctatg Intron 2 (33 to 51) No
Exon 3 F taaggctagtgtcttttcagg Intron 2 (–703 to –683) Yes 1164
R ccaggttcatctctaactc Intron 3 (292 to 310) Yes
Exon 4 F ctctgaacaccagtctcg Intron 3 (–132 to –115) Yes 701
R ctgcccgattttctattagcctc Intron 4 (399 to 421) Yes
Exon 5 F aaatgtggttagctggtatcag Intron 4 (–177 to –156) No 398
R tgtgtgctagtcctgttagacc Intron 5 (33 to 54) No
Exon 6 F gcagcaagatggtgttctct Intron 5 (–61 to –42) No 327
R ttgaagccaataagagaatgca Intron 6 (107 to 128) Yes
Exon 7 F ccatttggtggcgccggat Intron 6 (–97 to –79) Yes 505
R ctgctctgtgtttgtgggg Intron 7 (256 to 274) Yes
Exon 8 F gcccttcctggcaatggca Intron 7 (–103 to –85) No 257
R cacacggcagggtgcgct Intron 8 (57 to 74) No
Exon 9 F ggtccaggaatgacagggcg Intron 8 (–164 to –145) Yes 826
R caggcatgtgctaccacg Intron 9 (571 to 588) Yes
Exon 10 F caagagatcaagccaaaatcagt Intron 9 (–67 to 45) Yes 545
R ggaatgccagccaccttgtaaa 3’ UTR (152 to 173) Yes

*Numbers of the primer binding sites indicate their distances from the adjacent exon/intron boundaries according to the reference sequences (accession No. NM_020485.8 and NG_0009208.3).

**The distances from the start codon are –875 to –856.


(3)RHCE 유전형 판정

국제수혈학회(International Society of Blood Trans-fusion, ISBT)에서 제공하는 RHCE allele table (v6. 2-31-MAR-2022) 및 NCBI에서 제공하는 dbSNP 데이터베이스를 활용하여 Sanger sequencing 결과를 판독하였다[8]. 기준이 되는 염기서열은 NM_ 020485.8 및 NG_0009208.3을 사용하였다. RHCE genotyping 검사법 확립 과정에서 사용된 기존 연구과제 검체 20개의 경우 염기서열 분석 결과가 혈청학적 혈액형 검사 결과 및 상품화된 ID COREXT kit 검사 결과와 합당한지 비교함으로써 RHCE 유전형 검사법의 정확도를 확인하였다. 이후 모집한 D-- 헌혈자 8명의 검체를 대상으로 정립한 RHCE 유전형 검사법을 적용하여 검사를 시행하였으며, PCR-based electrophoresis 결과와 Sanger sequencing 판독 결과를 종합하여 RHCE 유전형을 판정하였다.

결과

1.혈청학적 Rh 혈액형 검사

D-- 연구참여자 8명에 대해 anti-D, anti-C, anti-c, anti-E, anti-e 항혈청 시약을 사용하여 표준 tube법으로 실온, 37℃ 및 AHG phase에서 응집반응을 확인한 결과 8명 모두 실온, 37℃, AHG 조건에서 D 항원은 강양성을 보이는 반면 C, c, E, e 항원은 응집반응 음성결과를 나타내어 혈청학적으로 D-- 형에 합당하였다.

2.보관검체 20개 대상 RHCE 유전형 검사

PCR 증폭산물에 대한 전기영동에서 20개 검체 모두에서 엑손 1부터 엑손 10까지 모든 엑손의 증폭이 확인되었다. 염기서열을 분석하고 유전학적 RHCE allele 유형을 판정한 결과 20명 모두에서 상용화된 ID COREXT 검사시스템을 이용한 기존 RHCE typing 결과와 부합하였다(Table 3).

RHCE allele types identified through Sanger sequencing

Sample No. Previous ID COREXT typing results Sanger sequencing results Correlation


C c E e RHCE allele type
1 RHCE*Ce, RHCE*cE or RHCE*ce, RHCE*CE Yes
2 RHCE*Ce, RHCE*cE or RHCE*ce, RHCE*CE Yes
3 RHCE*Ce Yes
4 RHCE*Ce Yes
5 RHCE*Ce Yes
6 RHCE*Ce Yes
7 RHCE*Ce Yes
8 RHCE*Ce Yes
9 RHCE*cE, RHCE*ce Yes
10 RHCE*cE, RHCE*ce Yes
11 RHCE*cE Yes
12 RHCE*cE Yes
13 RHCE*cE Yes
14 RHCE*cE Yes
15 RHCE*cE Yes
16 RHCE*cE Yes
17 RHCE*Ce, RHCE*ce Yes
18 RHCE*Ce, RHCE*ce Yes
19 RHCE*ce Yes
20 RHCE*ce Yes


3.D-- 헌혈자 대상 RHCE 유전형 검사

1)PCR-based electrophoresis

D-- 연구참여자 8명에 대해 PCR-based microfluidic capillary electrophoresis 검사를 시행하여 RHCE 유전자의 엑손별 증폭산물을 확인한 결과는 Table 4와 같다. 1, 3, 5, 7번 검체는 엑손 1부터 엑손 10까지의 모든 증폭산물이 확인되었으나 4, 6, 8번 검체는 엑손 3, 4, 6이 증폭되지 않았다. 또한 2번 검체의 경우 엑손 9 증폭산물이 예상 위치에서 벗어나 좀 더 큰 위치에 있었으며, 밴드의 모양 또한 폭이 좁고 뚜렷하지 않고 넓은 영역에 걸쳐 퍼져 있었다.

Polymerase chain reaction (PCR) products for each RHCE exons of 8 serological D-- blood donors on electrophoresis

Sample No. Exon 1 Exon 2 Exon 3 Exon 4 Exon 5 Exon 6 Exon 7 Exon 8 Exon 9 Exon 10
Expected size (base pair) 1146 1630 1164 701 398 327 505 257 826 545
1
2 No*
3
4 No No No
5
6 No No No
7
8 No No No

*Faint blurry band at a higher position than the other samples.


2)Sanger sequencing

PCR에서 증폭산물이 확인된 경우 Sanger sequencing을 진행하고 염기서열을 분석하여 변이를 확인하였다. 그 결과 1번부터 10번까지 모든 엑손에서 증폭반응이 확인된 1, 3, 5, 7번 검체의 경우 염기서열 분석결과 엑손 및 인접 인트론 부위에서 D-- 혈액형이나 RHCE 변이형을 유발하는 것으로 알려진 별다른 변이는 발견되지 않았다.

RHCE specific PCR primer로 엑손 3, 4, 6이 증폭되지 않고 엑손 5, 7에서는 RHD와 일치하는 염기서열변이가 확인되어 RHCE 유전자와 RHD 유전자간의 hybrid allele의 가능성이 높을 것으로 판단된 4, 6, 8번 검체의 경우 RHD 유전자와 RHCE 유전자의 염기서열이 일치하는 엑손 8에 대해 RHCE 1차 PCR 증폭산물을 RHD specific sequencing primer를 사용하여 2차 PCR 및 Sanger seque-ncing을 진행하였다. 그 결과 4, 6, 8번 검체 모두 463 bp 위치에서 뚜렷한 밴드를 확인할 수 있었으며 Sanger sequencing에서도 RHDRHCE 엑손 8과 일치하는 염기서열 결과를 확인하였다.

엑손 7에서 RHD와 일치하는 염기서열변이가 확인된 2번 검체 또한 엑손 8에 대해 4, 6, 8번 검체와 동일한 검사를 시행하여 같은 검사 결과를 얻었다. 한편 전기영동 시에 다른 검체들보다 큰 위치에서 흐릿하고 경계가 불분명한 밴드가 나타난 2번 검체 엑손 9에 대해서는 1차 PCR 산물에 대해 RHCE primer와 RHD primer를 적용하여 Sanger sequencing을 실시하였으나 염기서열 확인이 불가능하였다.

최종적인 RHCE allele 유전형은 PCR-based ele-ctrophoresis에서 엑손별 증폭 유무와 Sanger sequencing에서 발견된 염기서열 변이를 종합하여 판정하였으며 이를 정리하면 Table 5와 같다.

Molecular characteristics of 8 serological D-- blood donors

No. Location Nucleotidechanges Predicted amino acid changes RHCE structure ISBT allele name Predicted phenotype rs number
1 Exon 1 c.48G>C p.Trp16Cys - RHCE*CE or RHCE*04 RH:2 or C
RH:3 or E
RH:22 or CE
rs586178
Intron 1 c.149-20A>G - rs184592905
c.150C>T
c.178C>A
c.201A>G
c.203A>G
c.307C>T
p.Val50=
p.Leu60Ile
p.Ser67=
p.Asn68Ser
p.Pro103Ser
rs200955066
rs181860403
rs1053343
rs1053344
rs676785
Exon 5 c.676G>C p.Ala226Pro rs609320
2 5’ UTR –144C>S - RHD exon 7

(presumably RHD exons 7∼9)
No information No information rs201048836
Exon 1 c.48G>C p.Trp16Cys rs586178
Intron 1 c.149-20A>G - rs184592905
c.150C>T
c.178C>A
c.201A>G
c.203A>G
c.307C>T
p.Val50=
p.Leu60Ile
p.Ser67=
p.Asn68Ser
p.Pro103Ser
rs200955066
rs181860403
rs1053343
rs1053344
rs676785
Exon 7 c.941T>G
c.968A>C
c.974T>G
c.979G>A
c.985C>G
c.986A>G
c.989C>A
c.992T>A
c.1025C>T
c.1048C>G
c.1053T>C
c.1057T>G
c.1059G>A
c.1060A>G
c.1061A>C
NA NA
Intron 7 c.1073+152A>C
c.1073+216A>G
c.1073+250C>T
3 5’ UTR –144C>S - - RHCE*02 or RHCE*Ce RH:2 or C
RH:5 or e
RH:7 or Ce
rs201048836
Exon 1 c.48G>C p.Trp16Cys rs586178
Intron 1 c.149-20A>G - rs184592905
c.150C>T
c.178C>A
c.201A>G
c.203A>G
c.307C>T
p.Val50=
p.Leu60Ile
p.Ser67=
p.Asn68Ser
p.Pro103Ser
rs200955066
rs181860403
rs1053343
rs1053344
rs676785
Intron 4 c.634+179T>A - rs151230984
4 5’ UTR –144C>S - RHD exon 5
RHD exon 7

(presumablyRHD exons 3∼8)
RHCE*02N.07 RHCE*CeN.07 RH:–2,–5,–17 (C–e–)
(null phenotype)
rs201048836
Exon 1 c.48G>C p.Trp16Cys rs586178
Intron 1 c.149-20A>G - rs184592905
c.150C>Y
c.178C>M
c.201A>R
c.203A>R
c.307C>Y
p.Val50=
p.Leu60Ile
p.Ser67=
p.Asn68Ser
p.Pro103Ser
rs200955066
rs181860403
rs1053343
rs1053344
rs676785
Exon 5 c.667G>T
c.697C>G
c.712A>G
c.733C>G
c.744T>C
c.787A>G
c.800T>A
NA NA
Exon 7 c.941T>G
c.968A>C
c.974T>G
c.979G>A
c.985C>G
c.986A>G
c.989C>A
c.992T>A
c.1025C>T
c.1048C>G
c.1053T>C
c.1057T>G
c.1059G>A
c.1060A>G
c.1061A>C
Intron 7 c.1073+152A>C
c.1073+216A>G
c.1073+250C>T
5 5’ UTR c.-378G>A
c.-369C>T
c.-296G>A
c.-122C>A
- - RHCE*03.18 RHCE*cE.18
RHCE*04 RHCE*CE
RH:4 or c
RH:3 or E
RH:27 or cE

RH:2 or C
RH:3 or E
RH:22 or CE
rs2281179
rs2072933
rs2072932
rs2072931
Exon 1 c.48G>C p.Trp16Cys rs586178
Intron 1 c.149-20A>R - rs28631635
c.150C>T
c.178C>A
c.201A>G
c.203A>G
c.307C>T
p.Val50=
p.Leu60Ile
p.Ser67=
p.Asn68Ser
p.Pro103Ser
rs200955066
rs181860403
rs1053343
rs1053344
rs676785
Intron 3 c.486+157C>A - rs28631635
Exon 5 c.676G>C p.Ala226Pro rs609320
6
Exon 1 c.48G>C p.Trp16Cys RHD exon 5
RHD exon 7

(presumably RHD exons 3∼8)
RHCE*02N.07 RHCE*CeN.07 RH:–2,–5,–17 (C–e–)
(null phenotype)
rs586178
Intron 1 c.149-20A>G - rs184592905
c.150C>T
c.178C>A
c.201A>G
c.203A>G
c.307C>T
p.Val50=
p.Leu60Ile
p.Ser67=
p.Asn68Ser
p.Pro103Ser
rs200955066
rs181860403
rs1053343
rs1053344
rs676785
Exon 5 c.667G>T
c.697C>G
c.712A>G
c.733C>G
c.744T>C
c.787A>G
c.800T>A
NA NA
Exon 7 c.941T>G
c.968A>C
c.974T>G
c.979G>A
c.985C>G
c.986A>G
c.989C>A
c.992T>A
c.1025C>T
c.1048C>G
c.1053T>C
c.1057T>G
c.1059G>A
c.1060A>G
c.1061A>C
Intron 7 c.1073+152A>C
c.1073+216A>G
c.1073+250C>T
7 Exon 1 c.48G>C p.Trp16Cys - RHCE*02 or RHCE*Ce RH:2 or C
RH:5 or e
RH:7 or Ce
rs586178
Intron 1 c.149-20A>G - rs184592905
Exon 2 c.150C>T
c.178C>A
c.201A>G
c.203A>G
c.307C>T
p.Val50=
p.Leu60Ile
p.Ser67=
p.Asn68Ser
p.Pro103Ser
rs200955066
rs181860403
rs1053343
rs1053344
rs676785
Intron 4 c.634+179T>A - rs151230984
8 Exon 1 c.48G>C p.Trp16Cys RHD exon 5
RHD exon 7
RHCE*02N.07
RHCE*CeN.07
RH:–2,–5,–17
(C–e–) (null phenotype)
rs586178
Intron 1 c.149-20A>G - rs184592905
Exon 2 c.150C>T
c.178C>A
c.201A>G
c.203A>G
c.307C>T
p.Val50=
p.Leu60Ile
p.Ser67=
p.Asn68Ser
p.Pro103Ser
rs200955066
rs181860403
rs1053343
rs1053344
rs676785
Exon 5 c.667G>T
c.697C>G
c.712A>G
c.733C>G
c.744T>C
c.787A>G
c.800T>A
NA NA
Exon 7 c.941T>G
c.968A>C
c.974T>G
c.979G>A
c.985C>G
c.986A>G
c.989C>A
c.992T>A
c.1025C>T
c.1048C>G
c.1053T>C
c.1057T>G
c.1059G>A
c.1060A>G
c.1061A>C
Intron 7 c.1073+152A>C
c.1073+216A>G
c.1073+250C>T

Abbreviations: rs number, reference SNP cluster ID number; ISBT, International Society of Blood Transfusion.


고찰

D-- 혈액형은 전 세계에서 공통적으로 매우 드문 빈도를 보이나, 나라마다 보고된 빈도에는 차이가 있다. Haplotype frequency가 스웨덴에서는 0.0005이나 민족적으로 연관된 나라인 아이슬란드에서는 0.0047이며, 일본에서는 0.0032라는 보고가 있었다[9]. 일본에서는 Okubo [10]가 1991년 헌혈자 692,000명을 대상으로 한 조사에서 7명의 D-- 표현형 보유자가 확인되어 전체 헌혈자 중 0.00101%가 해당 혈액형을 보유하고 있는 것으로 보고되었다.

우리나라의 경우 2018년 1월부터 4월까지 대한적십자사에서 검사를 시행한 모든 헌혈자 876,920명을 대상으로 한 조사에서 혈청학적 자동화 장비로 선별검사를 시행한 결과 14명이 C, c, E, e 항원 음성 결과를 보였으며, 이들에 대해 수기로 혈청학적 확인검사를 시행한 결과 7명은 해당 항원을 약하게 발현하는 것으로 나타났고 최종적으로 7명의 D-- 보유자가 확인되었다[5]. 이는 전체 헌혈자 중 0.000798%의 빈도를 보이는 것으로, 일본에 비해 약 80% 수준에 해당한다.

RhCcEe 혈액형의 null phenotype을 유발하는 유전학적 변이에는 stop codon이 일찍 등장하는 nonsense mutation, 주형이 틀어지는 frameshift mutation, splicing에 영향을 주는 splice site variant, RHCE 유전자와 상동성이 높은 RHD 유전자 간에 발생하는 RHCE-RHD-RHCE hybrid 등이 있다[2,9-11]. 본 연구에서는 8명의 연구참여자들에게 연구과정에서 정립한 RHCE PCR-based electropherosis 및 Sanger sequencing 검사법을 적용하여 검사를 시행한 결과 절반인 4명에서는 RHCE 엑손 일부에서 RHCE specifc primer로 증폭이 되지 않거나, 증폭되더라도 RHD 엑손과 일치하는 염기서열을 보였다. 이는 RHCE 유전자와 RHD 유전자 간 RHCE-RHD-RHCE hybrid gene의 형성으로 인해 RHCE 유전자가 넓은 영역에 걸쳐 결손되어 RhCcEe 항원의 발현에 영향을 미친 것으로 판단되었다.

구체적으로는 상기 4명 중 3명에 해당하는 4, 6, 8번 검체에서 엑손 3, 4, 6이 RHCE specific PCR에서 증폭되지 않았고, 마찬가지로 RHCE specific PCR primer를 사용한 엑손 5, 7, 8은 증폭산물이 형성되었으나 염기서열분석에서 RHD와 일치하는 염기서열만이 확인되었다. 즉, PCR 단계에서 primer가 양방향 모두 RHCE 유전자에 특이적인 염기서열로 이루어져 있어 RHCE 영역만 증폭이 이루어지고 RHD 유전자 부위는 증폭되지 않으나, 이 PCR 증폭산물을 RHCE nonspecific exon 5, exon 8 sequencing primer 및 RHCE specific exon 7 sequencing primer로 염기서열분석검사를 진행한 결과에서는 RHCE 염기서열에 특이적인 변이가 아닌 RHD에 특이적인 염기서열만이 확인되었다. 이에 4, 6, 8번 검체는 RHCE 유전자의 3번부터 8번 exon에 이르는 영역이 RHD 유전자로 치환된 RHCE- RHD(3-8)-RHCE hybrid allele에 해당하는 RHCE*02N.07 or RHCE*CeN.07 allele의 가능성이 높을 것으로 판단되었으며, 해당 allele은 D-- 표현형을 나타내는 null allele로 ISBT에 보고되어 있다. 이는 RHD-RHCE(2-9)-RHD 또는 RHD- RHCE(3-8)-RHD 재조합에 의해 RHD 유전자의 산물이 결핍되어 D 음성 혈액형이 되는 것과 동일한 현상이다[12]. 다만 본 연구에서 사용한 RHCE PCR primer는 각 엑손 별 forward and reverse primer pair에서 하나 또는 두 primer 모두가 RHCE 유전자에 특이적인 염기서열로서 RHD 유전자와는 1개 이상의 염기에서 차이가 있으나, 이들 primer가 엑손 5∼6, 7, 8의 1st PCR 단계에서 어떻게 anealing이 되고 증폭이 이루어질 수 있었는지는 primer 결합 부위의 구체적인 염기서열을 확인할 수 없어 판단이 어려웠다.

한편 2번 검체는 엑손 9에서 비정상적인 PCR 증폭반응을 보였고, 엑손 7 및 8에서 RHD 엑손과 일치하는 염기서열을 나타내어 RHCE-RHD(7-9)- RHCE hybrid allele가 존재할 가능성이 높을 것으로 판단되었다. 이러한 재조합 양상의 allele는 기존에 보고된 적이 없는 allele로, 어떠한 형태의 폴리펩타이드 산물이 형성되는지는 명확하지 않은 상황이다. 다만 이 검체에서도 exon 7 및 8에 대해 RHCE 유전자에 특이적인 forward and reverse primer를 (1st) PCR에서 사용하였으나, 이들 primer가 어떻게 anealing이 되고 증폭이 이루어질 수 있었는지는 primer 결합 부위의 구체적인 염기서열을 확인할 수 없어 판단하기 어려웠다.

2, 4, 6, 8번 검체에서 발견된 모든 변이는 동형접합체(homozygote) 형태로 확인되었다. 이는 동일한 유형의 allele를 부모 양쪽으로부터 물려받은 결과일 수 있으나, CE-D-CE hybrid 유형의 allele가 RHCE 거대결손(gross deletion)과 동반되었을 가능성도 있다. 2000년 Okuda 등[13]은 염색체 1p 34.3- 36.1에 위치한 RHCE 유전자와 인접한 1p 36.1- 36.3 D1S80 유전자자리(locus)의 존재 여부를 확인한 결과 모계로부터 유래된 D1S80 locus의 소실을 확인하여, 모계로부터 유래된 RHCE gene or RH genes 거대결손과 부계로부터 유래된 hybrid CE- D-CE gene이 복합되어 D-- 표현형이 발생하였을 가능성이 높다고 판단된 사례를 보고한 바 있다. 다만 RHCE 유전자의 거대결손이 발생하는 기전 및 양상이 사례마다 제각각이므로, 이들이 사용한 검사법을 모든 D-- 표현형 사례의 확인에 동일하게 적용하기는 어려울 것으로 보인다.

본 연구에 참여한 8명의 D-- 헌혈자 중 4명(1, 3, 5, 7번)에서는 일반적인 C, c, E, e 항원을 발현하는 RHCE*CE RHCE*Ce RHCE*cE allele에 해당하는 변이 이외에 D-- 표현형의 원인이 될 만한 별다른 유전자 변이는 확인되지 않았다. 다만 인트론 1에 위치한 c.149-20A>G (rs184592905) 변이는 그 빈도가 한국인 인구집단에서 0.0233 또는 0.0073으로 보고된 바 있고 세계적으로도 가장 높은 빈도를 보인 경우가 0.031로서 매우 드문 변이로 알려져 있는데, 본 연구에서는 5번 검체에서 이형접합체(heterozygote)로, 그 외 나머지 7개 검체 모두에서 동형접합체 형태로 해당 변이가 확인되어 D-- 표현형을 유발한 변이일 가능성이 제기되었다. 그러나 RHCE gene sequencing 검사법 검증 당시 여러 C, c, E, e 항원 양성 조합의 정상 RhCcEe 혈액형 검체에 대해 Sanger sequencing을 시행한 염기서열 정보를 확인한 결과, C 항원 양성인 검체에서는 해당 변이를 모두 보유하고 있는 것이 확인되었으며, 특히 RHCE*Ce 동형접합체에서는 해당 변이가 동형접합의 형태로 발견되었으나 C, e 항원의 발현에 영향을 미치지 않았다. 따라서 해당 변이는 D-- 표현형의 원인 유발 변이의 가능성에서 제외되었다.

본 연구의 RHCE 유전자 염기서열분석 범위 내에서는 D-- 표현형을 유발할만한 원인변이를 발견할 수 없었던 1, 3, 5, 7번 검체의 경우 C, c, E, e 항원을 약하게 발현한다고 알려져 있는 다른 변이도 발견되지 않았으며 모든 엑손에서 정상 위치에 증폭 밴드가 나타났고 정상적인 RHCE allele에 해당하는 염기서열분석 결과를 보였으므로, 이들 검체는 적어도 1개 또는 한 쌍의 RHCE 유전자좌에서 거대결손이 발생하지 않은 RHCE allele를 보유하고 있는 것으로 판단된다. 이 4개 검체에서 D-- 표현형이 발생한 원인으로는 우선 RHCE 유전자 내부에서 본 연구의 염기서열분석 범위인 –850 bp까지의 5’ UTR과 각 엑손 및 근접 인트론 영역에 포함되지 않은 부위에서 발생한 변이가 D-- 표현형을 발현하였을 가능성이 있을 것으로 판단된다. 이를 확인하기 위해서는 역전사 중합효소 연쇄반응(reverse transcription polymerase chain reaction)을 통해 cDNA를 합성하여 mRNA 서열을 확인하거나, RHCE 유전자의 전체 coding 및 non- coding region에 대해 차세대 염기서열분석(next generation sequencing, NGS) 실험을 수행하는 등의 추가적인 방법을 고려할 수 있을 것이다. 다만 본 연구에서 적용한 primer 및 RHCE 유전자 분석 범위는 현재까지 ISBT에 등재된 D-- 혈액형의 원인변이를 모두 포함하고 검출할 수 있도록 설계되었으며, 아직까지는 본 연구 검사범위 이외의 RHCE 유전자 내부 영역에서 발생한 변이가 D-- 표현형을 발생시킨다는 보고는 없는 상황이다. 따라서 만일 이렇게 NGS 등의 차세대 분석 방법을 적용하여 새로운 원인 변이가 발견된다면 D-- 표현형을 유발하는 신규 변이가 된다. D-- 표현형은 전세계적으로 매우 드물기 때문에 아직까지 원인 변이에 대한 규명이 불충분하여, 현재도 상기 표현형을 유발하는 신규 변이들이 지속적으로 보고되고 있다.

한편 RHCE 유전자와 멀리 떨어져있는 다른 유전자 영역에서 발생한 변이에 의해 D-- 표현형이 유발되었을 가능성도 있다. Rh-null phenotype의 경우 RH locus 내부의 변이에 의해 발생한 amorph type이 아닌, RH locus와는 연관되어 있지 않은 suppressor gene 또는 associated gene의 변이에 의해 발생한 regulator type의 Rh-null phenotype도 존재하는 것이 알려져 있다[14]. D-- 표현형에서 이렇게 원거리에 위치하는 원인 변이를 발견하기 위해서는 D-- 표현형을 보이는 수많은 가족을 대상으로 전장유전체분석(whole genome sequencing)을 시행하는 것이 필요하다. 다만 D-- 표현형은 전 세계적으로 매우 드물며, 전장유전체분석 검사에는 막대한 비용이 소모되므로 현실적으로 이러한 연구 방법을 적용하기에는 어려움이 많다고 하겠다.

본 연구에서는 대한적십자사의 헌혈자 중 혈청학적 수기검사에서 D-- 표현형을 나타내는 것으로 확인된 헌혈자 18명 중 총 8명의 연구참여자를 모집하여 RHCE PCR-based electrophoresis 및 염기서열 분석을 시행하고 D-- 표현형을 유발한 원인 변이를 고찰하였다. 그 결과 혈청학적 D-- 헌혈자 8명 중 4명에서 RHCE 유전자와 RHD 유전자간 재조합 변이가 확인되었고 그중 3명에서 RHCE*02N.07 or RHCE*CeN.07 allele가 존재할 가능성을 확인할 수 있었으며 이는 한국인에서 D-- 혈액형의 발생 기전 중 가장 높은 빈도의 allele로 판단되었다. 이 3명의 헌혈자들은 혈청학적 검사에서뿐 아니라 유전학적으로도 진성(true) D-- 혈액형임이 확인된 헌혈자로서, 이처럼 혈청형과 유전형이 모두 확인된 헌혈자의 정보를 활용하면 보다 안전한 수혈이 가능할 것으로 기대된다.

요약

배경: 대한적십자사에서는 RhCE 항원에 대한 혈청학적 검사를 통해 총 18명의 D-- 헌혈자를 발굴하였다. 본 연구에서는 이 헌혈자들을 대상으로 RHCE genotyping 검사를 시행하여 한국인에서 D-- 혈액형의 분자유전학적 특성을 확인하려 하였다.

방법: RHCE specific PCR-based electrophoresis를 통해 각 exon별 증폭반응 양상을 확인하였으며, Sanger sequencing을 진행하고 염기서열 변이를 확인하였다. 검사결과를 종합하여 RHCE 유전형을 판정하였다.

결과: 18명의 D-- 헌혈자 중 8명이 연구에 참여하였다. PCR-based electrophoresis에서는 4, 6, 8번 검체의 exon 3, 4, 6이 증폭되지 않았고 2번 검체의 exon 9도 비정상적 band 양상을 나타내었다. 4, 6, 8번 검체는 exon 5, 7, 8의 염기서열이 RHD와 일치하였으며 RHCE-RHD(3-8)-RHCE hybrid allele의 가능성이 높을 것으로 판단되었다. 2번 검체는 exon 7, 8에서 RHD와 일치하는 염기서열이 확인되었다. 한편 1, 3, 5, 7번 검체에서는 D-- 표현형을 유발한다고 알려져 있는 별다른 변이가 확인되지 않았다.

결론: 총 8명의 D-- 연구참여자 중 4명에서 일부가 RHD 유전자로 치환된 RHCE 유전자가 확인되었고, 그중 3명이 RHCE*02N.07 allele로 동정되어 유전학적으로도 RHCE null allele로 판단되었다. 추후 RHCE 유전자 전체 영역을 확인할 수 있는 검사법을 적용한다면 별다른 변이가 발견되지 않은 검체들의 유전학적 기전을 파악하는 데에 도움이 될 것으로 예상된다.

References
  1. Smart E, Armstrong B. Blood group systems. ISBT Sci Ser 2020;15(S1):123-50.
    Pubmed CrossRef
  2. Avent ND, Reid ME. The Rh blood group system: a review. Blood 2000;95:375-87. Erratum in: Blood 2000;95:2197.
    Pubmed CrossRef
  3. Hustinx H. DGTI Register of Rare Donors. Transfus Med Hemother 2014;41:338-41.
    Pubmed KoreaMed CrossRef
  4. Cho EH, Chun S, Seo JY, Kang ES, Cho D, Kim DW. A system for cryopreservation of rare red blood cell units; right time to start. Korean J Blood Transfus 2015;26:323-5.
    CrossRef
  5. Lee MK, Jung SY, Kim JU, Kim JP, Kim DH, Park JR. -D-/-D- Phenotype frequency among Korean donors. Korean J Blood Transfus 2018;29:182-7.
    CrossRef
  6. Han JH, Kwon SY, Jekarl DW. Transfusion of a D--phenotype patient using the Rare Blood Donor Registry of the Korean Red Cross Blood Services. Blood Transfus 2021;19:91-2.
    Pubmed KoreaMed CrossRef
  7. Fasano RM, Monaco A, Meier ER, Pary P, Lee-Stroka AH, Otridge J, et al. RH geno-typing in a sickle cell disease patient contribu-ting to hematopoietic stem cell transplantation donor selection and management. Blood 2010;116:2836-8.
    Pubmed KoreaMed CrossRef
  8. Sherry ST, Ward M, Sirotkin K. dbSNP-data-base for single nucleotide polymorphisms and other classes of minor genetic variation. Genome Res 1999;9:677-9.
    Pubmed CrossRef
  9. Flatt JF, Musa RH, Ayob Y, Hassan A, Asidin N, Yahya NM, et al. Study of the D-- phe-notype reveals erythrocyte membrane alterations in the absence of RHCE. Br J Haematol 2012;158:262-73.
    Pubmed CrossRef
  10. Okubo Y. Pretransfusion testing with special reference to blood groups (in Japanese). Tokyo: Ishiyaku Publishers Inc. , :40-1.
  11. Ochoa-Garay G, Moulds JM, Cote J, Kresie L, Garaizar A, Goldman M, et al. New RHCE variant alleles encoding the D-- phenotype. Transfusion 2013;53(S11):3018-23.
    Pubmed CrossRef
  12. Bae GE, Kim TY, Yu H, Seo JY, Cho D. The first Korean case of RHD-CE(3-8)-D hybrid type with a d-negative phenotype. Lab Med Online 2022;12:201-4.
    CrossRef
  13. Okuda H, Fujiwara H, Omi T, Iwamoto S, Kawano M, Ishida T, et al. A Japanese pro-positus with D-- phenotype characterized by the deletion of both the RHCE gene and D1S80 locus situated in chromosome 1p and the exis-tence of a new CE-D-CE hybrid gene. J Hum Genet 2000;45:142-53.
    Pubmed CrossRef
  14. Cartron JP. RH blood group system and mole-cular basis of Rh-deficiency. Baillieres Best Pract Res Clin Haematol 1999;12:655-89.
    Pubmed CrossRef

 

April 2024, 35 (1)
Full Text(PDF) Free

Social Network Service

Cited By Articles
  • CrossRef (0)

Author ORCID Information

Services