search for




 

The Experience of RHD Genotyping in D-negative Blood Donors
D 음성 헌혈자 대상 RHD 유전자 검사 시행 경험
Korean J Blood Transfus 2021;32:91−101
Published online August 31, 2021;  https://doi.org/10.17945/kjbt.2021.32.2.91
© 2021 The Korean Society of Blood Transfusion.

Taeeun Kim, M.S., Yunju Park, M.T., Leeseul Shin, M.S., Yu Soek Jung, M.D., Miae Youn, M.D., Yeongbin Kim, M.D.
김태은ㆍ박윤주ㆍ신이슬ㆍ정유석ㆍ윤미애ㆍ김영빈

Korean Red Cross Blood Transfusion Research Institute, Wonju, Korea
대한적십자사 혈액수혈연구원
Yeongbin Kim, M.D.
Korean Red Cross Blood Transfusion Research Institute, 50 Hyeoksin-ro, Wonju 26465, Korea
Tel: 82-33-811-0241, Fax: 82-33-811-0209, E-mail: krcmdkyb@redcross.or.kr, ORCID: https://orcid.org/0000-0003-2904-8166
Received April 29, 2021; Revised July 23, 2021; Accepted July 27, 2021.
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
Background: There have been some domestic and overseas cases of anti-D alloimmunization caused by the transfusion of serologically D-negative blood. However, it is difficult to distinguish between true D-negative and DEL variants using conventional serologic typing. Therefore, we established the RHD genotyping algorithm for the detection of DEL variants and applied this algorithm to serologic D negative donors who voluntarily consented to testing.
Methods: From September 2016 to December 2020, 216 RhD negative donors who were C+ and/or E+ in previous serologic typing were recruited. The screening test was PCR amplification of the RHD exons 4, 7, 10, and a promotor. Based on the results of PCR screening, true D-negative samples and RHD variants (including DEL) were discriminated. When the result was a RHD variant, exon 9 was sequenced to identify the nucleotide changes. Full sequencing was performed if no mutations were detected at exon 9.
Results: Among the 216 participants, 39 cases with the C−E−c+e+ phenotypes that did not meet the recruitment criteria were excluded from data analysis. Among the remaining 177 samples, 68 cases (38.4%) were RHD total deletions, 35 cases (19.8%) were RHD-CE-D hybrids, and 74 cases (41.8%) were RHD variants. Among the cases of RHD variants, 73 cases (98.6%) had c.1227G>A substitutions and were confirmed as Asian-type DEL.
Conclusion: Seventy-four cases of serologic D negative donors were reclassified as RHD variants by RHD genotyping. This is believed to have contributed to the improvement of transfusion safety by lowering the risk of anti-D alloimmunization in D-negative patients.
Keywords : RHD genotyping, DEL, D negative blood donors
서 론

RhD 혈액형은 ABO 혈액형 다음으로 면역원성이 높은 것으로 알려져 있으며, D 음성 환자가 D 항원에 노출되면 동종면역반응에 의해 항-D 항체가 생성되어 태아신생아용혈질환(hemolytic disease of fetus/newborn, HDFN)이나 용혈수혈반응(hemolytic transfusion reaction)을 유발할 수 있다[1,2]. RhD 혈액형에는 D 양성, D 음성 외에도 D 항원의 양적 감소나 질적 결손이 발생하는 D 변이형이 있으며, 약-D형, 부분-D형 그리고 DEL형이 대표적인 D 변이형에 해당한다.

이중 DEL형은 일반적인 혈청학적 약-D형 검사로는 검출되지 않을 정도로 D 항원이 극소량만 존재하여 흡착-해리 검사(adsorption & elution test)로만 확인이 가능하다[3-5]. 그러나 흡착-해리 검사는 과정이 복잡하여 검사자의 높은 숙련도가 요구되며, 재현성이 좋지 않은 한계를 지니고 있어 DEL형 확인을 위한 일상검사로 적용하기에는 한계가 있다. 따라서 일반적인 혈청학적 혈액형 검사에서 D 음성으로 판정된 DEL형 혈액이 D 음성 환자에게 수혈되어 항-D 항체가 생성되고 이로 인해 동종면역이 유발된 사례들이 국내외에서 보고되고 있다[6-8].

위와 같은 이유로 혈청학적 D 음성 헌혈자에 대해 DEL 변이형을 확인할 수 있는 적절한 RHD 유전형 검사법 개발의 필요성이 제기되어, 대한적십자사는 Aubin 등[9], Kim 등[10], Luttringhaus 등[11], Fasano 등[12]이 보고한 바를 바탕으로 2014년 하반기부터 자체 연구를 진행하여 높은 정확도로 완전한 D 음성과 DEL 변이형을 감별할 수 있는 RHD 유전형 검사법을 정립한 후 이를 실제로 혈청학적 D 음성 헌혈자를 대상으로 하는 검사에 적용할 수 있는 알고리즘을 구축하였다.

이후 대한적십자사에서는 구축된 알고리즘에 따라 2016년 9월부터 혈청학적 D 음성 다회헌혈자 중 거의 모두가 RHD 유전자의 전체결손에 의한 D 음성인 것으로 알려져 있는 cde 표현형인 경우는 제외하고[13] C 양성이거나 E 양성인 헌혈자를 대상으로 자유 의사에 따른 동의 하에 RHD 유전형 검사를 시행하고 있으며, 그 결과를 혈액정보관리시스템(Blood Information Management System, 이하 BIMS)에 등록하여 DEL과 같은 D 변이형으로 확인된 헌혈자의 혈액이 D 음성혈액으로 출고되는 것을 방지함으로써 수혈의 안전성을 확보하고자 노력하고 있다.

본 논문에서는 2016년 9월부터 2020년 12월까지 혈청학적 D 음성 헌혈자를 대상으로 시범 실시한 RHD 유전형 검사의 누적결과를 활용하여 혈청학적 D 음성 한국인 헌혈자에서 DEL형과 같은 D 변이형의 분포 유형을 분석하고 그 결과를 고찰하고자 한다.

대상 및 방법

1. 대상

2016년 9월부터 대한적십자사 헌혈의 집을 방문한 만 19세 이상 혈청학적 D 음성 다회헌혈자 중 C 양성이거나 E 양성인 분들에 대해 RHD 유전형 검사가 시범적으로 실시되었다. 자발적 의사에 따라 참여에 동의하신 분을 대상으로 검사가 시행되었다. 본 연구에서는 2016년 9월부터 2020년 12월까지 시행된 검사 결과를 후향적으로 분석하였으며 해당 연구는 대한적십자사 혈액관리본부 생명윤리심의위원회의 승인을 받았다. (IRB no. 20-15차-신-3).

2. 방법

1) 검체 채취

혈청학적 D 음성 다회헌혈자가 헌혈을 하기 위하여 헌혈의집을 방문하였을 때 헌혈지원자 접수 전산조회 시 BIMS에 입력되어있는 최근 헌혈시의 Rh 표현형 검사결과가 C 양성이거나 E 양성인 경우 검사대상자임을 알리는 안내가 표시되며, 이를 확인한 간호사가 RHD 유전형 검사와 관련된 내용을 충분히 설명한 후 검사 시행에 대한 동의를 구하였다. 자발적 의사에 따라 검사에 참여한 헌혈자에게 연구참여 동의서, 유전자검사 동의서, 인체유래물 연구동의서를 확보하였으며, 검사를 위해 EDTA 튜브에 전혈 3 mL를 채혈하였다.

2) 혈청학적 Rh 항원(C, c, D, E, e) 검사

대한적십자사 혈액검사센터에서 모든 헌혈혈액을 대상으로 Rh 혈액형 항원(C, c, D, E, e)에 대한 혈청학적 선별검사를 자동화 장비인 PK 7300 (Olympus, Hamburg, Germany)와 SIHDIA anti-D (신양화학약품, 시흥, 한국), anti-C, c, E, e (Diagast, Loos, France) 시약을 이용하여 실시하였다. 이 중에서 D 항원의 선별 초회검사 결과가 음성 또는 미결정이거나 과거 직전 검사 결과와 불일치(Delta Check)하는 경우에는 두 종류 이상의 anti-D 시약(신양화학약품; Ortho clinical diagnostics, Raritan, USA)을 사용하여 수기법으로 선별재검사를 실시하였다. 실온에서 응집강도가 3+ 이상일 경우 D 양성으로 판정하였으며, 2+ 이하인 검체에 대해서는 추가적으로 37℃ 및 AHG (anti-human globulin) 단계의 weak-D 검사를 실시하여 여기서 음성인 경우 최종적으로 혈청학적 D 음성으로 판정하였다(Fig. 1). C, c, E, e 항원의 경우에는 자동화 장비를 사용한 선별검사에서 완전 음성인 경우 각 해당 항원 음성으로 결과가 입력되며, 약양성을 비롯한 그 외의 경우에는 각 해당 항원 양성으로 결과가 입력되었다.

Fig. 1. Algorithm for RHD genotyping in serological D-negative donors with C and/or E positive phenotype.

3) RHD 유전형 검사

RHD 유전형 검사는 대한적십자사 혈액수혈연구원에서 진행되었다(Fig. 1). 혈액수혈연구원은 혈액원에서 배송된 검체를 접수하고 헌혈일 기준 10일 이내에 검사를 실시하였다.

(1) DNA 추출

2016년 9월부터 2018년 10월까지는 자동 핵산추출 장비인 MagNaPure LC 1.0 (Roche Dianostics, GmbH, Germany)와 MagNa Pure DNA isolation kit I (Roche Diagnosics, GmbH, Germany)을 사용하여 DNA를 추출하였다. 2018년 11월 이후에는 SLA- D14800 (TANBead, Taoyuan, Taiwan) 장비와 TANBead Nucleic Acid Extraction kit (TANBead, Taoyuan, Taiwan)을 사용하였다.

(2) PCR 선별검사

RHD 유전자의 promoter, exon 4, exon 7, exon 10 각 부위에 특이적인 primer를 사용하여 PCR을 시행하였다(Table 1) [9,14]. 이 때 내부대조(internal control)를 위해 인간성장호르몬(human growth hormone, HGH) 유전자 부위에 대한 증폭을 함께 시행하였다. PCR 반응액은 AmpliTaq Gold 360 Master Mix (Applied Biosystems, Foster, USA)에 primer set (바이오니아, 대전, 한국)와 internal control (HGH) primer set (바이오니아, 대전, 한국)을 더하여 총 부피를 25 µL로 맞춘 다음 Veriti 96 well Thermal Cycler (Applied Biosystems, Foster, USA) 장비를 사용하여 증폭을 시행하였다. PCR 조건은 95℃에서 10분간 pre-denaturation한 다음, 95℃에서 30초간 denaturation, 50℃ (exon 4, exon 10) 또는 57℃ (exon 7, promoter)에서 30초간 annealing, 72℃에서 30초간 extension 하는 과정을 40 cycle 반복하고 마지막으로 72℃에서 7분간 final-extention을 진행하였다. 이러한 과정을 거친 PCR 증폭산물을 Lab Chip GX (Caliper Life Sciences, Hopkinton, USA) 장비를 사용하여 전기영동을 시행하고 증폭 여부를 확인하였다. Promoter, exon 4, exon 7, exon 10의 네 부위 모두에서 증폭이 확인되지 않을 경우 RHD 유전자의 “완전 결손(total deletion)”으로, promoter와 exon 10 부위만 증폭이 되는 경우 “RHD-CE-D hybrid”로 판정하였으며, 이 두 가지 경우는 D 항원이 진음성(true negative)인 D 음성으로 결과를 보고하였다. PCR 검사에서 네 부위 모두 증폭반응을 보일 경우에는 유전적 변이가 존재하는 RHD 변이형으로 판정하고 이 혈액제제가 D 음성혈액으로 출고되지 않도록 BIMS에 “DEL 양성”으로 결과를 입력하였다. 검사 결과는 검사에 참여한 헌혈자에게 안내문으로 발송하였다.

Primer sequences used for the PCR screening tests

Target gene Primer Sequence (5’→3’) Amplicon size (bp) Reference
Promoter F TCCACTTTCCACCTCCCTGC 256 [14]
R GCAGCCAACTTCCCCTGTG
Exon 4 F CCACATGAACATGATGCACA 127 [9]
R CAAACTGGGTATCGTTGCTG
Exon 7 F GTTGTAACCGAGTGCTGGGGATTC 123 [14]
R TGCCGGCTCCGACGGTATC
Exon 10 F TAAGCAAAAGCATCCAA 186 [9]
R ATGGTGAGATTCTCCT
HGH (internal control) F TGCCTTCCCAACCATTCCCTTA 434
R CCACTCACGGATTTCTGTTGTGTTTC


(3) Exon 9 sequencing

PCR 선별검사에서 RHD 변이형으로 판정된 경우 exon 9에 대한 염기서열분석을 시행하였으며 이 때 사용한 primer는 Table 2, 3과 같다[15]. 먼저 염기서열분석에 사용할 exon 9 증폭산물을 확보하기 위해 AmpliTaq Gold 360 Master Mix (Applied Biosystems, Foster, USA)를 사용하여 총 부피를 25 µL로 맞추고 Veriti 96 well Thermal Cycler (Applied Biosystems, CA, USA) 장비를 이용하여 PCR을 진행하였다. PCR 조건은 annealing 온도를 57℃로 하여 PCR 선별검사와 같은 조건으로 진행하였다. 증폭된 PCR 산물을 Lab Chip GX (Caliper Life Sciences, Hopkinton, USA)를 통해 확인한 후 QIAquik PCR Purification Kit (Qiagen, Ailden, Germany)로 정제하여 염기서열분석에 사용하였다.

PCR Primers used in RHD exon 9 sequencing and full exon sequencing

Target gene Primer Sequence (5’→3’) Amplicon size (bp) Reference
Exon 1 F TGTGTAACTATGAGGAGTCAG 846 [12]
R TGGGGGAATCTTTTTCCTTGGG
Exon 2 F TGACGAGTGAAACTCTATCTCGAT 1478 [12]
R CCTGGATTCCTTGTGATACACG
Exon 3 F GGGACAGTGGCCCCAGATGG 929 [12]
R TGTTGCCCAGCTCGGTCC
Exon 4∼6 F TAAGCTCTGAACACCAGTCTCA 2690 [12]
R CTTCAGCCAAAGCAGAGGAGG
Exon 7 F CATCCCCTTTGGTGGCC 405 [12]
R AAGGTAGGGGCTGGACAG
Exon 8 F CTGGAGGCTCTGAGAGGTTGAG 463 [12]
R TGGCAATGGTGGAAGAAAGG
Exon 9 F TACTGTCGTTTTGACACACAATATTTC 301 [15]
R GTTCCTCCTGCAATGCTCCT
Exon 10 F CAAGAGATCAAGCCAAAATCAGT 1,062 [12]
R ATGAGGCCAAGAGATCCTGGTG


염기서열분석을 위해 BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster, USA)을 사용하여 sequencing PCR을 실시하고, 3130xl Genetic Analyzer (Applied Biosystems, Foster, USA) 장비를 이용해 염기서열분석을 진행하였다. 2018년 4월 이후에는 3500DX Genetic Analyzer (Thermo Fisher Scientific, Waltham, USA) 장비를 사용하여 염기서열분석을 진행하였다.

분석된 염기서열로부터 변이 존재 여부를 판독할 때에는 Sequencher 5.4 (Gene Codes Corp., Ann Arbor, USA) 프로그램을 이용하였다. RHD 유전자 기준염기서열은 NM_016124과 NG_007494을 사용하였다. 1227번째 guanine 염기가 adenine으로 치환된 변이가 발견될 경우 “Asia-type DEL”로 판정하였으며, 그 외에도 1222번째 thiamine이 cytosine으로 치환된 변이와 같이 Del 표현형을 유발하는 다른 변이의 존재 유무도 확인하였다.

(4) Full sequencing

Exon 9에 대한 염기서열 분석에서 D 변이형 여부가 정확히 확인되지 않는 미결정인 경우 exon 9을 제외한 나머지 exon 1∼10 부위에 대해서도 exon 9과 같은 방법으로 염기서열분석을 진행하였다. 이때 사용한 primer는 Table 2, 3와 같다[12].

결 과

1. 대상

2016년 9월부터 2020년 12월까지 총 216명의 혈청학적 D 음성 다회헌혈자가 자발적 동의하에 RHD 유전형 검사에 참여하였다. 이 중 혈액수혈연구원에서 혈청학적 Rh 혈액형 검사결과를 확인하였을 때 대상자 조건에 해당되지 않으나 모집 시 문진 과정의 오류로 검체가 채혈된 cde 표현형인 경우가 39건이 확인되어, 이 검체들은 제외하고 C 양성이거나 E 양성인 나머지 177건의 RHD 유전형 검사 결과에 대해 검토를 진행하였다.

2. C, c, E, e 항원 표현형 빈도

분석 대상자 177명의 RhCE 혈액형 항원 표현형 빈도는 Ccde가 61.6%로 가장 높은 빈도를 보였으며, cdEe가 24.9%, Cde가 6.2%, CcdEe가 4.5%, 그리고 cdE는 2.8%의 분포를 보였다.

3. RHD 유전형 검사

1) PCR 선별검사

PCR-SSP법을 사용하여 RHD 유전자의 promoter, exon 4, exon 7, exon 10 부위의 증폭 유무를 확인한 결과 완전 결손이 38.4%인 68건, RHD-CE-D hybrid가 19.8%인 35건이었으며, 나머지 74건(41.8%)은 RHD 변이형으로 판정되었다. 각 유전학적 기전별로 C, c, E, e 항원의 표현형 빈도를 정리하면 Table 4과 같으며, 완전 결손에서는 cdEe 표현형이, RHD-CE-D hybrid와 RHD 변이형은 Ccde 표현형이 가장 빈도가 높게 나타났다.

2) 염기서열분석

PCR 선별검사에서 변이형으로 판정된 74건에 대하여 exon 9에 대한 염기서열분석을 실시한 결과 Asia-type DEL에 해당하는 c.1227G>A 변이가 총 73건의 검체에서 확인되었으며, 나머지 1건의 검체에서는 exon 9에서 별다른 변이가 검출되지 않았다. 변이가 확인되지 않은 1건은 exon 9 이외의 나머지 exon 1∼10 부위에 대한 full sequencing 검사를 진행하였으나 검체가 변질되어 정확한 결과 분석을 할 수 없었으며, 이에 다른 exon 부위에 존재하는 변이의 존재가 확인되지 못한 미결정 검체로 처리하였다.

고 찰

헌혈혈액에 대한 RhD 혈액형 검사는 수혈 받는 환자에서 항-D 항체가 형성되는 동종면역을 예방하기 위한 목적으로 실시한다. 국내 헌혈자의 RhD 혈액형 검사 절차는 1차적으로 항-D 항혈청 시약과 적혈구를 반응시키는 혈청학적 검사를 실시하여 응집이 관찰되면 D 양성으로 판정하며, 응집이 관찰되지 않는 경우에는 추가적으로 약-D 검사를 실시하여 음성인 경우는 D 음성으로 최종 판정하고 D 음성 혈액으로 출고하게 된다.

그런데 혈청학적으로는 D 항원이 음성이나, 수혈 시 D 음성 환자에게 동종면역을 유발할 수 있는 D 변이형에 대한 다양한 사례가 국내외에서 보고되었으며, 이에 독일[16], 스위스[17], 및 오스트리아[18] 등 많은 국가에서는 RHD 유전형 검사를 의무화하여 진행하고 있다.

이에 국내에서도 혈청학적 D 음성 헌혈자에 대한 RHD 유전형 검사법 도입을 통해 D 변이형 여부를 확인하여야 할 필요성이 제기되었으며, 대한적십자사 혈액수혈연구원에서는 2014년 10월부터 서울, 인천, 경기, 대전, 울산, 대구 지역의 Rh 음성 헌혈자 모임을 통하여 확보한 검체 중 혈청학적 검사에서 D 음성 결과를 보인 247명을 대상으로 자체 연구 과제를 진행하여 2015년 초에 완전한 D 음성과 D 변이형을 높은 정확도로 신속하게 구별할 수 있는 한국인에게 적합한 RHD 유전형 검사체계를 확립하였다[19].

연구 결과를 기반으로 RHD 유전형 검사 도입에 대한 실질적인 논의를 거쳐 대한적십자사에서는 2016년 9월부터 자발적으로 검사에 동의한 혈청학적 D 음성 다회헌혈자를 대상으로 RHD 유전형 검사를 시범적으로 실시하고 있다. PCR 선별검사가 완료되기 전까지는 채혈 혈액의 출고가 보류되며, 선별검사 결과가 RHD 유전자 완전 결손과 RHD-CE-D hybrid인 경우에는 D 음성 혈액으로 출고하고, RHD 변이형으로 판정된 경우에는 DEL 양성으로 분류하고 있다. 선별검사에서 RHD 변이형으로 확인되면 추가적인 염기서열 분석검사를 실시하여 RHD 변이형을 유발한 유전변이에 대한 확인을 진행하며, 그 중 RHD exon 9에서 c.1227G>A 변이가 확인될 경우 Asia type DEL형으로 판정하였다.

2020년 12월까지 검사 대상인 C 양성이거나 E 양성인 혈청학적 D 음성 검체 177건 중에서 RHD 변이형은 74건으로 41.8%의 빈도를 보였다. 이는 C, c, E, e 항원 표현형을 고려하지 않고 혈청학적 D 음성헌혈자 전체를 대상으로 검사를 진행하였던 자체 연구에서의 결과인 19.0%보다 두 배 이상 더 높은 RHD 변이형 빈도이다. 또한 대부분의 인구집단에서 D 음성 일배체형(haplotype)은 ce 표현형과 관련이 있고, D 양성 일배체형은 C 또는 E를 가지고 있는 것으로 알려져 있다[20]. 따라서 혈청학적 D 음성인 헌혈자 모두를 RHD 유전형 검사 대상으로 하는 것보다는 이 중에서 C 양성이거나 E 양성인 경우를 우선적인 대상자로 하는 것이 D 변이형을 발견하는데 훨씬 비용 효율적으로 판단되며, 이는 기존의 보고[21,22]들과 동일하였다.

이와 같이 혈청학적 D 음성 헌혈자에게 RHD 유전형 검사를 시범적으로 실시하여 유전학적 RHD 변이형 존재 유무를 확인하였으며, 이 혈액제제가 D 음성 환자에게 수혈되어 항-D 항체를 유발할 가능성을 차단하기 위해 DEL 양성 헌혈자로 재분류 함으로써 수혈 안전에 어느 정도 기여할 수 있었다. 하지만 현재 시범실시의 경우 대상 헌혈자의 동의 하에 진행되는 검사이므로 자발적인 참여가 이루어지지 않으면 검사를 진행할 수 없기 때문에 아직까지는 극히 일부의 혈청학적 D 음성 다회헌혈자 대상으로 검사가 이루어지고 있는 실정이다. 보다 적극적으로 수혈 안전을 고려하여 D 변이형으로 인한 동종면역 발생을 예방하기 위해서는 RHD 유전형 검사 시행에 별도의 동의여부 확인이 필요 없도록 관련 제도를 마련하고 일상 검사로 확대해야 할 필요성이 제기된다.

RHD 유전형 검사를 일상검사로 전면 확대하려면 D 음성 혈액의 수급 문제에 대해 고려해야 한다. 먼저 RHD 유전형 검사를 실시하게 되면 PCR 선별검사가 완료되기 전까지는 채혈혈액의 출고가 보류됨에 따라 혈액 출고에 영향을 줄 수 있다. 헌혈자로부터 채혈이 이루어진 순간부터 선별검사가 종료될 때까지 소요되는 시간에는 검체 운송 등 여러 요소가 관여하나, 이 중 검사 소요시간의 경우 자체 검토 결과에 따르면 검체 48건 이하일 경우를 기준으로 검체 접수 후 PCR 선별검사까지 최대 소요 시간이 통상근무일 24시간 이내로 확인되었다. 이러한 검사 소요시간을 단축하는 방법으로는 RHD promotor, exon 4, exon 7, exon 10 부위에 대한 PCR 선별검사를 single PCR이 아닌 multiplex PCR로 시행하는 방법[23] 등을 고려해 볼 수 있다.

또한 한국인에서 D 음성의 빈도는 0.15%로 극히 드문 상황에서 D 음성 혈액제제 전체를 대상으로 RHD 유전형 검사가 도입될 경우 혈청학적으로 D 음성인 헌혈자 중 약 17%가 DEL형으로 재분류될 것으로 예상되며, 이에 따라 필연적으로 D 음성 혈액제제의 공급이 감소하게 될 것으로 보인다[5,13]. 따라서 RHD 유전형 검사를 전면적으로 실시하려면 D 음성 혈액제제의 수요 또한 비슷한 비율로 감소시키기 위한 여러 노력들이 이루어져야 한다.

2016년 발간된 대한수혈학회 수혈가이드라인 제4판에서는 D 변이형 중 RHD 유전자 분석으로Asia-type DEL(1227G>A)로 규명된 환자는 수혈이나 임신으로 D 항원에 노출되어도 항-D를 유발한 사례가 보고된 예가 없어 RhD 양성혈액 수혈이 가능하다고 규정하였다. 국내의 경우 Park 등[24]과 Choi 등[25]의 수혈 경험 사례에서 이를 확인할 수 있었다. 또한 임신을 두려워할 수 있는 D 음성 여성 헌혈자들 중 검사를 통해 Asia-type DEL형으로 확인될 경우 예방적 목적의 Rh 면역글로불린(RhIG) 투여가 필요하지 않다고 보고된 바가 있다[26]. 이와 같은 보고를 활용하여 DEL 변이형 여부를 확인할 수 있는 RHD 유전형 검사의 장점을 부각시킨다면 D 음성 헌혈자의 RHD 유전형 검사 참여를 독려할 수 있고 수혈자의 안전도 향상시킬 수 있을 것으로 사료된다.

향후 RHD 유전형 검사가 혈청학적 D 음성 헌혈자 전체를 대상으로 전면적으로 도입될 경우 D 음성혈액의 수혈전략 및 DEL형 혈액제제의 사용에 대해 의료기관을 대상으로 홍보 및 교육이 사전에 다양하게 이루어져야 할 것으로 사료된다.

요 약

배경: 혈청학적으로 D 음성인 혈액제제가 항-D 동종면역을 유발한 사례들이 국내외에서 보고되고 있다. 그러나 일반적인 혈청학적 혈액형 검사로는 완전한 D 음성과 DEL 변이형을 구별하기 어렵다. 이에 대한적십자사에서는 DEL형을 감별하기 위해 RHD 유전형 검사 알고리즘을 구축하고 자발적으로 동의한 헌혈자에게 이를 적용하여 검사를 시행하였다.

방법: 이전의 혈청학적 검사에서 C 양성이거나 E 양성인 D 음성 헌혈자를 대상으로 검사 참여자를 2016년 9월부터 2020년 12월까지 216명 모집하였다. 먼저 PCR 선별검사를 실시하여 RHD 유전자 중 promoter, exon 4, exon 7, exon 10 부위의 증폭 양상 결과에 따라 DEL형을 포함한 RHD 변이형과 완전한 D 음성을 구분하였다. RHD 변이형 검체인 경우 exon 9에 대해 염기서열분석을 진행하여 유전적 변이를 확인하였으며, exon 9에서 변이가 확인되지 않은 경우 RHD full sequencing을 진행하였다.

결과: 검사에 참여한 216명 중 C-E-c+e+ 표현형인 39건은 모집 기준에 부합하지 않아 결과 분석에서 제외하였다. 나머지 177건 중에서 RHD 완전결손은 68건(38.4%), RHD-CE-D hybrid는 35건(19.8%), RHD 변이형은 74건(41.8%)이었다. 변이형 검체 74건 중 73건(98.6%)에서 Asian-type DEL에 해당하는 c.1227G>A 변이가 확인되었다.

결론: 혈청학적 D 음성 헌혈자에게 RHD 유전형 검사를 실시하여 총 74명의 혈청학적 D 음성 헌혈자를 RHD 변이형으로 재분류할 수 있었다. 이를 통해 D 음성 환자에게 항-D 항체 발생의 위험도를 낮춤으로써 수혈안전도 향상에 기여하였을 것으로 사료된다.

References
  1. Avent ND, Reid ME. The RH blood group system: a review. Blood 2000;95:375-87.
    Pubmed CrossRef
  2. Scott SA, Nagl L, Tilley L, Liew YW, Condon J, Flower R, et al. The RHD(1227G>A) DEL- associated allele is the most prevalent DEL allele in Australian D-blood donors with C+ and/or E+ phenotypes. Transfusion 2014;54:2931-40.
    Pubmed CrossRef
  3. Kwon DH, Sandler SG, Flegel WA. DEL phenotype. Immunohematology 2017;33:125-32.
    Pubmed KoreaMed CrossRef
  4. Körmöczi GF, Gassner C, Shao CP, Uchikawa M, Legler TJ. A comprehensive analysis of DEL types: partial DEL individuals are prone to anti-D alloimmunization. Transfusion 2005;45:1561-7.
    Pubmed CrossRef
  5. Yang HS, Chun SJ, Lee SA, Kwon JR, Choi YS, Kim JN, et al. Transfusion strategy of RHD-negative/variant patients in the Korean population. Lab Med Online 2017;7:89-93.
    CrossRef
  6. Wagner T, Körmöczi GF, Buchta C, Vadon M, Lanzer G, Mayr WR, et al. Anti-D immunization by DEL red blood cells. Transfusion 2005;45:520-6.
    Pubmed CrossRef
  7. Kim KH, Kim KE, Woo KS, Han JY, Kim JM, Park KU. Primary anti-D immunization by DEL red blood cells. Korean J Lab Med 2009;29:361-5.
    Pubmed CrossRef
  8. Yang HS, Lee MY, Park TS, Cho SY, Lee HJ, Lim G, et al. Primary anti-D alloimmunization induced by "Asian type" RHD (c.1227G>A) DEL red cell transfusion. Ann Lab Med 2015;35:554-6.
    Pubmed KoreaMed CrossRef
  9. Aubin JT, Le Van Kim C, Mouro I, Colin Y, Bignozzi C, Brossard Y, et al. Specificity and sensitivity of RHD genotyping methods by PCR-based DNA amplification. Br J Haematol 1997;98:356-64.
    Pubmed CrossRef
  10. Kim JY, Kim SY, Kim CA, Yon GS, Park SS. Molecular characterization of D- Korean persons: development of a diagnostic strategy. Transfusion 2005;45:345-52.
    Pubmed CrossRef
  11. Luettringhaus TA, Cho D, Ryang DW, Flegel WA. An easy RHD genotyping strategy for D- East Asian persons applied to Korean blood donors. Transfusion 2006;46:2128-37.
    Pubmed CrossRef
  12. Fasano RM, Monaco A, Meier ER, Pary P, Lee-Stroka AH, Otridge J, et al. RH genotyping in a sickle cell disease patient contributing to hematopoietic stem cell transplantation donor selection and management. Blood 2010;116:2836-8.
    Pubmed KoreaMed CrossRef
  13. The Korean Society of Laboratory Medicine. Laboratory medicine. 6th ed. Seoul: Panmun Education, 2021:1353-4.
  14. Wagner FF, Frohmajer A, Flegel WA. RHD positive haplotypes in D negative Europeans. BMC Genet 2001;2:10.
    Pubmed KoreaMed CrossRef
  15. Silvy M, Simon S, Gouvitsos J, Di Cristofaro J, Ferrera V, Chiaroni J, et al. Weak D and DEL alleles detected by routine SNaPshot genotyping: identification of four novel RHD alleles. Transfusion 2011;51:401-11.
    Pubmed CrossRef
  16. Flegel WA, von Zabern I, Wagner FF. Six years' experience performing RHD genotyping to confirm D-red blood cell units in Germany for preventing anti-D immunizations. Transfusion 2009;49:465-71.
    Pubmed CrossRef
  17. Crottet SL, Henny C, Meyer S, Still F, Stolz M, Gottschalk J, et al. Implementation of a mandatory donor RHD screening in Switzerland. Transfus Apher Sci 2014;50:169-74.
    Pubmed CrossRef
  18. Polin H, Danzer M, Gaszner W, Broda D, St-Louis M, Pröll J, et al. Identification of RHD alleles with the potential of anti-D immunization among seemingly D-blood donors in Upper Austria. Transfusion 2009;49:676-81.
    Pubmed CrossRef
  19. Lee SA. Establishment of RHD genotyping algorithm for Korean RHD negaive blood donors. Internal research project. Final report. Wonju: Blood Transfusion Research Institute; 2016. Report No.: 2014-I02 [Unpublished work].
  20. American Association of Blood Banks. Technical manual. 20th ed. Bethesda: American Association of Blood Banks, 2020:334.
  21. Wagner FF. RHD PCR of D-negative blood donors. Transfus Med Hemother 2013;40:172-81.
    Pubmed KoreaMed CrossRef
  22. Seo MH, Won EJ, Hong YJ, Chun S, Kwon JR, Choi YS, et al. An effective diagnostic strategy for accurate detection of RHD variants including Asian DEL type in apparently RHD- negative blood donors in Korea. Vox Sang 2016;111:425-30.
    Pubmed CrossRef
  23. Kim Y. Study for establishment of multiplex PCR method in RHD genotyping for identification of D variant and performance evaluation. Internal research project. Final report. Wonju: Blood Transfusion Research Institute; 2019. Report No.: 2018-I01 [Unpublished work].
  24. Park JY, Cho D, Choi HW, Jeon MJ, Park MS, Song JW, et al. A patient with RHDel (1227G>A) failed to produce detectable anti-D after transfusion of RHD positive red blood cells. Korean J Blood Transfusion 2006;17:153-8.
  25. Choi S, Chun S, Seo JY, Yang JH, Cho D. Planned transfusion of D-positive blood components in an Asia type DEL patient: proposed modification of the Korean national guidelines for blood transfusion. Ann Lab Med 2019;39:102-4.
    Pubmed KoreaMed CrossRef
  26. Shao CP, Xu H, Xu Q, Sun GD, Li JP, Zhang BW, et al. Antenatal RH prophylaxis is unnecessary for "Asia type" DEL women. Transfus Clin Biol 2010;17:260-4.
    Pubmed CrossRef

 

August 2021, 32 (2)
Full Text(PDF) Free

Social Network Service

Cited By Articles
  • CrossRef (0)

Author ORCID Information
Services