The Korean Journal of Blood Transfusion : eISSN 2383-6881 / pISSN 1226-9336

Table. 2.

Table. 2.

Primer sequences for Sanger sequencing

Target region Primer Sequence (5’→3’) Binding site RHCE specific Amplicon size (bp)
5’ UTR to exon 1 F gaactaagtcccaagccccg 5’ UTR (–836 to –817)** Yes 1146
Exon 2 F tccagctgccatttagtaagactc Intron 1 (–92 to –69) No 330
R ggggtccattccctctatg Intron 2 (33 to 51) No
Exon 3 F taaggctagtgtcttttcagg Intron 2 (–703 to –683) Yes 1164
R ccaggttcatctctaactc Intron 3 (292 to 310) Yes
Exon 4 F ctctgaacaccagtctcg Intron 3 (–132 to –115) Yes 701
R ctgcccgattttctattagcctc Intron 4 (399 to 421) Yes
Exon 5 F aaatgtggttagctggtatcag Intron 4 (–177 to –156) No 398
R tgtgtgctagtcctgttagacc Intron 5 (33 to 54) No
Exon 6 F gcagcaagatggtgttctct Intron 5 (–61 to –42) No 327
R ttgaagccaataagagaatgca Intron 6 (107 to 128) Yes
Exon 7 F ccatttggtggcgccggat Intron 6 (–97 to –79) Yes 505
R ctgctctgtgtttgtgggg Intron 7 (256 to 274) Yes
Exon 8 F gcccttcctggcaatggca Intron 7 (–103 to –85) No 257
R cacacggcagggtgcgct Intron 8 (57 to 74) No
Exon 9 F ggtccaggaatgacagggcg Intron 8 (–164 to –145) Yes 826
R caggcatgtgctaccacg Intron 9 (571 to 588) Yes
Exon 10 F caagagatcaagccaaaatcagt Intron 9 (–67 to 45) Yes 545
R ggaatgccagccaccttgtaaa 3’ UTR (152 to 173) Yes

*Numbers of the primer binding sites indicate their distances from the adjacent exon/intron boundaries according to the reference sequences (accession No. NM_020485.8 and NG_0009208.3).

**The distances from the start codon are –875 to –856.

Korean J Blood Transfus 2023;34:92-107 https://doi.org/10.17945/kjbt.2023.34.2.92
© 2023 Korean J Blood Transfus