The Korean Journal of Blood Transfusion : eISSN 2383-6881 / pISSN 1226-9336

Table. 1.

Table. 1.

Primer sequences used for the PCR screening tests

Target gene Primer Sequence (5’→3’) Amplicon size (bp) Reference
Promoter F TCCACTTTCCACCTCCCTGC 256 [14]
R GCAGCCAACTTCCCCTGTG
Exon 4 F CCACATGAACATGATGCACA 127 [9]
R CAAACTGGGTATCGTTGCTG
Exon 7 F GTTGTAACCGAGTGCTGGGGATTC 123 [14]
R TGCCGGCTCCGACGGTATC
Exon 10 F TAAGCAAAAGCATCCAA 186 [9]
R ATGGTGAGATTCTCCT
HGH (internal control) F TGCCTTCCCAACCATTCCCTTA 434
R CCACTCACGGATTTCTGTTGTGTTTC
Korean J Blood Transfus 2021;32:91-101 https://doi.org/10.17945/kjbt.2021.32.2.91
© 2021 Korean J Blood Transfus