The Korean Journal of Blood Transfusion : eISSN 2383-6881 / pISSN 1226-9336

Table. 2.

Table. 2.

PCR Primers used in RHD exon 9 sequencing and full exon sequencing

Target gene Primer Sequence (5’→3’) Amplicon size (bp) Reference
Exon 1 F TGTGTAACTATGAGGAGTCAG 846 [12]
R TGGGGGAATCTTTTTCCTTGGG
Exon 2 F TGACGAGTGAAACTCTATCTCGAT 1478 [12]
R CCTGGATTCCTTGTGATACACG
Exon 3 F GGGACAGTGGCCCCAGATGG 929 [12]
R TGTTGCCCAGCTCGGTCC
Exon 4∼6 F TAAGCTCTGAACACCAGTCTCA 2690 [12]
R CTTCAGCCAAAGCAGAGGAGG
Exon 7 F CATCCCCTTTGGTGGCC 405 [12]
R AAGGTAGGGGCTGGACAG
Exon 8 F CTGGAGGCTCTGAGAGGTTGAG 463 [12]
R TGGCAATGGTGGAAGAAAGG
Exon 9 F TACTGTCGTTTTGACACACAATATTTC 301 [15]
R GTTCCTCCTGCAATGCTCCT
Exon 10 F CAAGAGATCAAGCCAAAATCAGT 1,062 [12]
R ATGAGGCCAAGAGATCCTGGTG
Korean J Blood Transfus 2021;32:91-101 https://doi.org/10.17945/kjbt.2021.32.2.91
© 2021 Korean J Blood Transfus