search for




 

Analysis of HIV RNA Genotypes and Quantitative Values of HIV NAT Reactive Blood Donations
HIV 핵산증폭검사 양성 헌혈 혈액의 바이러스 유전자 정량 및 유전자형 분석
Korean J Blood Transfus 2020;31:141−152
Published online August 31, 2020;  https://doi.org/10.17945/kjbt.2020.31.2.141
© 2020 The Korean Society of Blood Transfusion.

Jung-won Kang, M.S.1, Jae-won Kang, M.S.1, Dae Ho Ko, M.S.1, Miae Youn, M.D.1, So-Yong Kwon, M.D.2
강정원1ㆍ강재원1ㆍ고대호1ㆍ윤미애1ㆍ권소영2

Korean Redcross Blood Transfusion Research Institute, Korean Red Cross1, Wonju; Blood Service Headquaters, Korean Red Cross2, Wonju, Korea
대한적십자사 혈액수혈연구원1, 대한적십자사 혈액관리본부2
Jae-won Kang, M.S.
Blood Transfusion Research Institute, Korean Red Cross, 50 Hyeoksin-ro, Wonju 26465, Korea
Tel: 82-33-811-0216, Fax: 82-33-811-0240, E-mail: kangjaewon@redcross.or.kr, ORCID: https://orcid.org/0000-0001-9030-4494
Received April 3, 2020; Revised June 19, 2020; Accepted June 22, 2020.
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
Background: The Korean Red Cross adopted HIV NAT for blood donor screening in 2005 using a minipool assay. In June 2012, the NAT system was replaced with the individual assay. This study examined the characteristics of HIV NAT reactive blood donors to determine if there was any difference in their features between 10 years ago and later.
Methods: This study analyzed the HIV RNA quantitative values and the distribution of HIV subtypes using 118 HIV NAT positive blood donations (37 in 2007, 20 in 2008, 32 in 2017 and 29 in 2018).
Results: No significant variations of the quantitative values of HIV RNA and the distribution of HIV subtypes 10 years ago and later were observed. This study failed to produce quantitative values of three samples due to the low titer. The mean titer of HIV RNA of the remaining 115 samples were 5.14×104 IU/mL. The dominant HIV subtype of the HIV NAT reactive donors was B showing 54.2% (64/118). Approximately 5.9% (7/118) of the samples showed the HIV subtype C. Forty-seven samples (39.8%) showed the circulating recombinant form (CRF).
Conclusion: The rate of HIV subtype B in this study (54.2%) has decreased compared to the results of the past study (95.2%). Some of the cases showing CRF were identified as B in the past study because CRF3, 8, 9, 14, and 15 are recombinant forms, including subtype B.
Keywords : HIV, Quantitative assay, Subtype
서론

수혈에 의한 사람면역결핍바이러스(human immunodeficiency virus, HIV) 전파의 예방을 위하여 모든 헌혈 혈액에 대하여 HIV 항체검사와 핵산증폭검사(nucleic acid Amplification Test, NAT)를 실시하고 있다. HIV NAT의 경우 우리나라에서는 2005년 2월에 처음 도입하였으며, 당시에는 Cobas Ampliscreen을 이용한 24 pool과 Procleix assay를 이용한 16 pool의 minipool 검사를 적용하다가, 2012년 6월부터는 Procleix Ultrio plus assay를 이용한 개별검사를 적용하고 있다. 헌혈 혈액에서의 HIV NAT 양성을 보이는 경우는 연간 40∼60건 정도로 나타나고 있으며, 이 중 연간 약 5건 내외 정도는 HIV 항체검사에서는 음성 결과를 보이는 것으로 나타나고 있다.

HIV는 다양한 변이의 존재와 유전적 다양성으로 인하여 치료제 개발 및 검사 시약의 성능 향상에 대한 지속적인 연구를 요하고 있다[1,2]. HIV는 1형(HIV-1)과 2형(HIV-2)으로 구분되며, HIV-1의 경우 M, O 및 N의 세 개의 그룹으로 나뉘고, 감염자의 대부분을 차지하는 M 그룹은 A∼D, F∼H, J, K의 9개의 subtype으로 구분된다[3]. 서로 다른 subtype 간에는 25∼30%의 염기서열의 차이가 존재하지만, 같은 subtype 내에서도 15∼20%의 염기서열의 차이가 나타나는 것으로 알려져 있다[4]. 또한 2종 이상의 서로 다른 subtype을 지닌 바이러스의 조합으로 인한 circulating recombinant form (CRF)이 존재하며, Los Alamos National Laboratory HIV sequence database에 따르면 98종의 CRF가 확인되어 있는 것으로 나타나 있다[5].

HIV의 subtype은 지역적으로 그 분포의 차이를 보이는 것으로 알려져 있어 남부 아프리카 지역의 경우는 subtype C가 주로 발견되며[6], 유럽[7] 및 북미[8], 호주[9], 남미[10]에서는 subtype B가, 러시아의 경우는 subtype A가[11], 중국[12,13]의 경우는 CRF01-AE 및 CRF07_BC가 주로 발견되는 것으로 보고되고 있다. 우리나라의 경우는 질병관리본부에서 1985∼2006년 동안 나타난 HIV 감염인 중 무작위 선정 834명에 대한 검사 결과 subtype B가 680명(81.5%)으로 가장 많았으며, 그 밖에도 subtype A, C, D, F, G, H형도 확인된 것으로 나타나 있다[14]. 그리고 국내 헌혈 혈액에 대한 HIV NAT 도입 직후인 2005년 2월부터 2006년 7월까지 HIV NAT 양성 결과를 보인 헌혈 혈액 80건에 대한 검사에서는 모두 subtype B로 나타났으며[15], 2007년 9월부터 2010년 2월 동안 HIV NAT 양성 헌혈 혈액 90건에 대한 검사 결과에서는 subtype이 확인된 85건 중 82건이 subtype B였고 subtype A, C 및 G가 한 건씩 나타난 사례가 있었다[16].

대한적십자사 혈액수혈연구원에서는 국내 HIV 양성 헌혈 혈액에 대한 연구 및 검사 시약의 성능 평가 등의 소재로의 활용을 위하여 HIV NAT 양성 결과를 보인 헌혈 혈액을 장기간 보관하고 있다. HIV 양성 헌혈 혈액에 대한 성상은 국내 HIV 감염 환자의 성상을 간접적으로 반영할 수 있을 것으로 보이며, 또한 특이 유전자형을 지닌 감염 혈액과 저역가 감염 혈액의 경우에는 향후 검사 시약의 민감도 및 특이도 평가를 위한 재료로서의 가치가 높으므로 특별히 선별할 필요가 있을 것으로 판단되었다. 이에 본 연구에서는 국내 HIV NAT 양성 혈액에 대한 바이러스 유전자 역가 및 유전자형을 분석함으로써 10년 전후 HIV RNA 역가 및 HIV subtype 분포의 차이 여부 관찰과 향후 임상 평가에 적합한 시료의 확보를 위한 참고 자료를 얻고자 하였다.

대상 및 방법

1. 대상

대한적십자사 혈액수혈연구원에 보관되어 있는 HIV NAT 양성 헌혈 혈액 중 2007년도 2008년도에 발생한 57건(2007년도 37건, 2008년도 20건)과 2017년도와 2018년도에 발생한 61건(2017년도 32건, 2018년도 29건)의 검체를 사용하였다.

2. 방법

1) HIV RNA 정량검사

Cobas Ampliprep/Cobas TaqMan system (Roche Diagnostics GmbH, Mannheim, Germany)과 Cobas Ampliprep/Cobas TaqMan system HIV-1 test version 2.0 (Roche Diagnostics GmbH, Mannheim, Germany)을 이용하여 혈장 850 μL로부터 HIV RNA의 추출 및 정량 검사를 실시하였다. 제조사 package insert에 따른 95% 검출한계는 16.5 copies/mL (27.5 IU/mL)이었으며, 정량값의 유효범위는 20∼107 copies/mL이었다.

2) HIV RNA 유전자형 분석

HIV 유전자형 분석을 위한 핵산 추출은 TANBead®Nucleic Acid Extraction kit (TAN Bead, Taoyuan, Taiwan)와 Smart LabAssist D14800 (TAN Bead, Taoyuan, Taiwan)을 이용하였으며 혈장 300 μL로부터 핵산을 추출하였다. 핵산 추출액으로부터 HIV-1 염기서열의 분석을 위하여 AmpliTaq Gold 360 Master Mix (Applied Biosystems, CA, USA)를 이용하여 HIV-1의 env 유전자 V3 domain 영역의 330 bp을 증폭하였다. 증폭에서 사용한 primer는 Table 1과 같다[17]. 이후 BigDye Direct cycle Sequencing kit (Applied Biosystems, CA, USA)를 이용하여 증폭 부위의 염기서열을 분석하였다. 염기서열 결과를 미국 국립생물공학 정보센터(National Center for Biotechnology Information, NCBI) 유전자 정보 분석 프로그램[18]에 입력하여 기존 데이터베이스 중 일치율이 가장 높은 HIV subtype을 확인하였으며, 그 밖에 Los Alamos National Laboratory의 HIV Blast [19], Luxemburg Institute of Health의 COMET Tool [20] 및 REGA HIV subtyping tool [21]에서 조회된 결과와 비교하였다.

HIV primer set for sequencing analysis

Target Primer Sequence(5’→3’) Amplicon size (bp)
External Outer F CACAGTACAATGTACACATG 330
Outer R ACAGTAGAAAAATTCCCCTC
Internal Inner F GCTGTTRAATGGCAGTCTAGCAGCAG
Inner R ATTTCTGGGTCCCCTCCTGACG

3) 계통발생학적 분석

미국 국립생물공학 정보센터 유전자 정보 분석 프로그램에 입력하여 기존 데이터베이스 중 일치율이 가장 높은 HIV subtype 및 gene accession number를 통해 계통발생관계를 분석하였다. ClustalW를 통해 염기서열을 비교하였고, MegaX, 10.1.8. 프로그램을 활용하여 Neighbor-Joining 법을 통해 Phylogenetic tree를 구성하였다.

4) 통계분석

통계적인 유의성은 chi-test를 이용하여 검증하였으며, 유의수준은 0.01로 하였다.

결과

1. HIV 정량값 분포

2007년도와 2008년도에 나타난 HIV NAT 양성 헌혈 혈액과 2017년도와 2018년도에 나타난 HIV NAT 양성 헌혈 혈액의 정량값의 분포는 Fig. 1과 같다. 전체 118개의 검체 중 3건은 정량 한계 미만으로 정량값을 도출하지 못하였으며, 정량값을 도출한 나머지 115건의 평균값은 5.14×104 copies/mL, 중앙값은 1.73×104 copies/mL (최대값은 6.38×105 copies/mL, 최소값은 1.34×102 copies/mL)로 나타났다.

Fig. 1. Distribution of viral load of HIV NAT reactive samples (2007, 2008, 2017, and 2018).

연도별 평균 정량값은 2007년도의 경우 3.68×104 copies/mL, 2008년도 6.78×104 copies/mL, 2017년도 6.13×104 copies/mL, 2018년도 4.72×104 copies/mL로 나타났으며 통계적으로 유의한 차이는 없었다. 정량 한계 미만으로 정량값을 도출하지 못한 3건은 모두 2018년도 헌혈 혈액에서 나타났으며(정량값을 도출한 검체에서의 최소값은 1.34×102 copies/mL), 2007년도 헌혈 혈액의 경우 정량 최소값은 6.90×102 copies/mL, 2008년도는 4.40×102 copies/mL, 2017년도는 3.08×102 copies/mL로 나타났다. 그리고 모든 연도에서 50% 이상이 104 copies/mL 이상에서 105 copies/mL미만의 정량값 범위에 해당하였다.

2. HIV subtype의 분포

1) NCBI genotyping program을 이용한 분석

총 118건에 대한 HIV 유전자 염기서열을 NCBI 유전자 정보 분석 프로그램을 통하여 분석한 HIV NAT 양성 헌혈 혈액에서의 HIV subtype의 분포는 Fig. 2와 같이 나타났다. 2007년과 2008년에 발생한 57건 중 29건(50.9%), 2017년과 2018년에 발생한 61건 중 35건(57.4%)이 subtype B로 나타나 가장 많은 분포를 보였다. C형은 2007년 및 2008년에는 4건(7.0%)과 2017년 및 2018년도에는 3건(4.9%)으로 나타났다. B형과 CRF 03형의 일치율이 동일하게 나타난 것이 2008년 1건, 2017년 2건, 2018년 3건이었으며, B형과 CRF 14형의 일치율이 동일하게 나타난 것이 2018년 1건 있었다. 40건은 CRF형태로 분석되었는데 CRF 중 가장 많은 분포를 보인 것은 CRF 03으로 2007년 및 2008년도에는 9건(15.8%), 2017년 및 2018년도에는 8건(13.1%)으로 나타났으며, CRF 14와 15도 2007년 및 2008년도와 2017년 및 2018년도 모두 나타났다. CRF 04, 06, 08의 경우 2007년 및 2008년도에만 확인되었고, 반면 CRF 09와 10의 경우는 2017년 및 2018년도에 발생한 혈액에서는 나타났다. Chi-test에 의한 검정 결과 2007, 8년도와 2017, 8년도의 통계적으로 유의한 차이는 없었다.

Fig. 2. Distribution of the HIV subtype of HIV NAT reactive donors (A. HIV NAT reactive donors in 2007 and 2008, B. HIV NAT, reactive donors in 2017 and 2018). The data was based on the results from the NCBI genotyping program. Abbreviations: NCBI, National Center for Biotechnology Information; CRF, circulating recombinant form.
2) 타 유전자형 분석 tool과의 비교

HIV 염기서열을 Los Alamos database의 HIV Blast에 입력하여 분석할 경우 118건 중 95건(80.5%)이 subtype B와의 일치율이 높은 것으로 나타났으며, 1건은 CRF 06으로 나타났다. 그리고 22건(18.6%)의 경우는 일치율이 높은 subtype을 찾지 못하였다. COMET Tool을 이용한 분석에서는 59건(50.0%)이 subtype B와 가장 일치하는 것으로 나타났으며, subtype A1 1건, subtype C 7건, subtype D 2건, subtype F1 1건, subtype G 3건, subtype H 1건, subtype J 1건으로 나타났고, 43건(36.4%)의 경우는 subtype을 찾지 못하였다. REGA HIV subtyping tool에서는 56건(47.5%)이 subtype B로 나타났으며, subtype A 1건, subtype D 2건, subtype G 1건, subtype J 1건으로 나타났고 57건(48.3%)은 일치율이 높은 subtype을 찾지 못하였다.

NCBI의 genotyping tool을 이용한 subtype 분석 결과를 타 분석 tool을 이용한 분석 결과와 비교한 내용은 Table 2와 같다. 4종의 tool에서 모두 같은 subtype으로 분석한 경우는 12건(10.2%) 뿐이었으며, 모두 subtype B로 분석되었다. 39건(33.1%)은 1종의 tool을 제외하고는 모두 subtype B로 판정한 사례였으며, 이 중 5건은 NCBI genotyping tool에서는 CRF로 분석하였으나 나머지 tool에서는 subtype B로 판정하였다. 1건은 REGA tool에서 subtype D로 판정하였고, COMET tool에서 subtype C 또는 G로 판정한 사례가 각각 1건씩 존재하였다. 45건(38.1%)의 경우에는 2종의 tool에서 subtype B로 분석한 사례였으며, Los Alamos HIV Blast와 COMET tool에서 subtype B로 판정한 경우가 21건, NCBI genotyping tool과 Los Alamos HIV Blast에서 subtype B로 판정한 경우가 11건, Los Alamos HIV Blast와 REGA tool에서 subtype B로 판정한 경우가 8건, NCBI genotyping tool과 COMET tool에서 subtype B로 판정한 경우가 4건, COMET tool과 REGA tool에서 subtype B로 판정한 경우가 1건으로 나타났다. 19건(16.1%)의 경우는 1개의 tool에서만 subtype B로 판정하였으며, COMET tool에서만 subtype B로 판정한 경우가 12건, Los Alamos HIV Blast에서만 subtype B로 판정한 경우가 4건, NCBI genotyping tool에서만 subtype B로 판정한 경우가 3건으로 나타났다. 3건의 경우는 4종의 tool에서 모두 subtype B로 판정하지 않았으며 이 중 1건은 NCBI genotyping tool과 Los Alamos HIV Blast에서 CRF 06으로, COMET tool과 REGA tool에서 subtype G로 판정한 결과를 보였다.

Comparison of the subtype with different tools

Tool Number


NCBI Los Alamos COMET REGA 2007 & 2008 2017 & 2018 Total
B B B B 11 1 12
B B B D 0 1 1
B B B NA 1 2 3
B B C B 3 0 3
B B G B 0 1 1
B B C NA 0 1 1
B B D NA 1 0 1
B B G NA 0 1 1
B B J NA 0 1 1
B B NA B 7 19 26
B B NA D 0 1 1
B B NA J 0 1 1
B B NA NA 2 3 5
B NA B NA 3 1 4
B NA A1 NA 0 1 1
B NA D NA 0 1 1
B NA NA NA 1 0 1
C B B NA 1 1 2
C NA B NA 3 1 4
C NA H NA 0 1 1
B/CRF 03 B NA B 1 5 6
B/CRF 14 B NA B 0 1 1
CRF 03 B B B 1 1 2
CRF 03 B NA B 0 1 1
CRF 03 NA B NA 2 2 4
CRF 03 B B NA 4 4 8
CRF 03 B C NA 1 0 1
CRF 03 B F1 NA 1 0 1
CRF 04 NA B NA 1 0 1
CRF 06 CRF 06 G G 1 0 1
CRF 08 NA NA NA 1 0 1
CRF 09 B C NA 0 1 1
CRF 10 B C NA 0 1 1
CRF 10 B B A 0 1 1
CRF 14 NA B NA 2 0 2
CRF 14 B B B 2 1 3
CRF 14 B B NA 2 1 3
CRF 15 B B NA 4 3 7
CRF 15 NA B B 0 1 1
CRF 15 NA B NA 1 0 1

Abbreviations: NA, not assigned; NCBI, National Center for Biotechnology Information; CRF, circulating recombinant form.


3) 계통발생학적 분석 결과

계통발생학적 분석 결과 15건의 경우에는 gene accession numer가 확인되지 않았으며, 43건의 경우는 각기 다른 gene accession number로 확인되었다. 43건의 일치율은 80% 미만으로 나타난 것이 2건, 80∼90%로 나타난 것이 16건, 90% 이상으로 나타난 것이 25건이었다. 16건의 경우는 8개의 gene accession number에 대하여 각각 2개의 검체가 동일 gene accession number를 보인 경우로 일치율은 80% 미만이 1건, 80∼90%가 9건, 90% 이상이 6건으로 나타났다. 그리고 gene accession number JQ028602.로 나타난 것이 3건(일치율 83.9∼89.4%), KC690659.1로 나타난 것이 3건(일치율 90.11∼93.98%)이었으며, KC690762.1로 나타난 것이 4건(일치율 82.46∼91.95%), AF314075.1로 나타난 것이 4건(일치율 77.42∼84.8%)이었다. HF947757.1로 나타난 것은 7건(일치율 80.3∼86.16%)이었고, KC690722.1으로 나타난 것이 19건(80∼92.17%)이었다. 각 검체별 데이터는 Table 3에 표시하였으며 이에 대한 phylogenetic tree는 Fig. 3과 같다.

Analysis of the sequencing identity rate between the sequencing results and GenBank sequence by subtype

No Subtype Gene accession No. Identity No Subtype Gene accession No Identity
1 B KT878039.1 89.93% 41 CRF3 KC690722.1 89.90%
2 B JQ028602.1 87.28% 42 CRF15 KC690619.1 93.53%
3 CRF10 AF422759.1 89.74% 43 B KC690806.1 86.38%
4 B KC690718.1 90.00% 44 B KC690674.1 92.31%
5 CRF10 Not confirmed 45 B Not confirmed
6 B KT878026.1 86.69% 46 B KC690722.1 90.68%
7 B KT878021.1 90.51% 47 CRF15 KC315252.1 91.78%
8 CRF9 U23487.1 77.27% 48 B/CRF3 KC690704.1 91.08%
9 C DQ313251.1 96.97% 49 B KC690829.1 91.59%
10 B KC690722.1 91.87% 50 B KM259491.1 93.02%
11 B AF314075.1 81.29% 51 CRF3 KC690722.1 91.08%
12 B JQ028602.1 89.40% 52 CRF3 KC690722.1 86.21%
13 CRF3 AF314075.1 83.77% 53 CRF3 HF947757.1 81.82%
14 B Not confirmed 54 CRF15 MK094501.1 75.86%
15 B JQ028602.1 83.90% 55 B/CRF14 KC690596.1 91.51%
16 B KC690841.1 92.12% 56 B KT878039.1 91.97%
17 B KC690587.1 92.00% 57 CRF15 EF425634.1 83.33%
18 B AF181411.1 83.62% 58 B AF200900.1 81.97%
19 B KC690832.1 90.28% 59 B KC690841.1 93.47%
20 C DQ313251.1 80.46% 60 CRF3 KC690722.1 89.19%
21 B KC690722.1 80.00% 61 B Not confirmed
22 B KC690722.1 91.35% 62 B KC690762.1 90.00%
23 CRF14 U36128.1 85.96% 63 C EF425634.1 85.96%
24 CRF3 Not confirmed 64 C Not confirmed
25 B/CRF3 KC690722.1 90.80% 65 B/CRF3 KC690722.1 91.93%
26 B KC690880.1 92.68% 66 CRF3 KC690762.1 89.66%
27 B KC690817.1 90.95% 67 B KC690722.1 92.17%
28 B KC690791.1 90.67% 68 CRF14 KC690659.1 93.68%
29 B KC690762.1 91.95% 69 CRF15 KM082498.1 81.65%
30 B KC690841.1 83.73% 70 B KC690522.1 92.22%
31 B/CRF3 KC690722.1 90.97% 71 CRF6 AY397579.1 88.79%
32 B KC690869.1 85.90% 72 CRF3 AJ877625.1 81.01%
33 B KC690722.1 91.88% 73 CRF3 KC690722.1 87.06%
34 B KC690859.1 83.33% 74 CRF15 HF947757.1 86.16%
35 B KC690841.1 92.62% 75 B KY113856.1 89.20%
36 CRF14 JX561550.1 89.38% 76 CRF3 KC690762.1 82.48%
37 B/CRF3 KC690722.1 89.86% 77 CRF3 KX960964.1 85.00%
38 B/CRF3 KC690722.1 90.14% 78 CRF3 Not confirmed
39 C HF947757.1 81.50% 79 B KC690497.1 91.35%
40 CRF3 HF947757.1 84.11% 80 CRF14 Not confirmed
81 B KC690722.1 91.13% 100 B AF034011.1 90.24%
82 B KC690727.1 93.84% 101 B MG185427.1 91.88%
83 B KC690447.1 88.79% 102 B KC690883.1 91.39%
84 B MG185310.1 86.67% 103 B KC690722.1 91.72%
85 B KC690711.1 94.79% 104 B KC690705.1 91.13%
86 CRF15 HF947757.1 83.73% 105 B KC690537.1 92.95%
87 C Not confirmed 106 B JF959698.1 91.85%
88 B Not confirmed 107 B Not confirmed
89 CRF15 KC690619.1 88.96% 108 B KC690659.1 93.98%
90 CRF14 DQ002162.1 83.44% 109 B Not confirmed
91 CRF15 AF314075.1 84.80% 110 C HF947757.1 80.30%
92 CRF14 KC690767.1 93.41% 111 CRF3 HF947757.1 82.86%
93 CRF14 AF314075.1 77.42% 112 CRF3 KC690868.1 81.59%
94 B KU896122.1 93.00% 113 B KC690727.1 90.98%
95 CRF8 Not confirmed 114 B KC690722.1 87.67%
96 B KC690806.1 89.14% 115 B KC690659.1 90.11%
97 B Not confirmed 116 B KC690447.1 92.31%
98 CRF4 Not confirmed 117 CRF14 KM082498.1 79.49%
99 B LC312036.1 91.32% 118 CRF3 KC690381.1 84.03%

Fig. 3. Phylogenetic tree of HIV-1 subtype from HIV NAT reactive blood donations.
고찰

본 연구는 국내 HIV NAT 양성 헌혈 혈액의 10년 전후 특성의 차이 여부를 관찰하고자 2007년과 2008년도의 헌혈 혈액과 2017년과 2018년도의 헌혈 혈액 중 HIV NAT 양성으로 본원에 보관되어 시료의 확보가 가능한 헌혈 혈액을 대상으로 HIV RNA 유전자 정량 분석과 유전자형 분석을 통한 HIV subtype의 분포를 조사하였다. 분석 결과 HIV NAT 양성 헌혈 혈액에서의 HIV RNA 유전자 정량값 및 subtype 분포에서 10년 전후 뚜렷한 차이는 관찰되지 않았다.

2007년과 2008년도의 경우에는 24개 또는 16개의 검체를 혼합한 minipool 검사로 HIV NAT를 시행하였고 당시 검사에 사용한 시약의 HIV-1의 95% 검출한계에 근거한 분석적 민감도 측정 결과 Cobas AmplScreen HIV-1 Test v1.5의 경우는 13.04 (9.33∼24.52) IU/mL, Procleix HIV-1/HCV multiplex assay의 경우는 13.56 (11.42∼17.05) IU/ mL이었다[22]. 2017년과 2018년의 경우에는 개별검체에 대하여 검사하였으며, 검사시약인 Procleix Ultrio plus assay의 HIV-1에 대한 95% 검출한계는 package insert에 의하면 21.2 (18.2∼25.7) IU/mL로 나타나 있다[23]. 대부분의 경우 정량 결과 103 copies/mL 이상의 결과를 보였으나, 정량 한계 미만으로 정량값을 도출하지 못한 3건은 모두 2018년도 헌혈 혈액으로 minipool 검사를 적용할 경우에는 검출하지 못할 가능성을 배제할 수 없기 때문에 현행과 같이 개별검체에 대한 검사의 안전성을 입증하였다.

HIV subtype 분포의 경우 과거 연구와 마찬가지로 subtype B가 가장 많은 비율을 차지하였으나, 본 연구에서는 과거 연구결과보다 subtype B의 비율이 더 낮게 나타났다. 과거 연구결과에서는 확인되지 않았던 다양한 CRF형이 확인되었는데 CRF의 경우 두 종류 이상의 subtype의 재조합으로 인하여 나타나는 것으로 알려져 있다. 본 연구 결과 CRF 중 가장 많은 비율을 차지한 CRF 03의 경우 subtype A와 subtype B의 재조합으로 여겨지며, 그 밖의 CRF 08, 14, 15의 경우에도 subtype B가 포함된 재조합의 결과로 추정되기 때문에 유전자 분석 프로그램에서의 일치율 판정 여부에 따라 과거 연구에서는 B로 추정되었을 가능성이 있다고 사료되었다. 또한 본 연구 뿐 아니라 국내 HIV 감염자 및 HIV NAT 양성 헌혈 혈액에 대한 유전자 분석에서는 HIV의 유전자 염기서열 분석을 env gene의 V3 domian에 한정하였기 때문에 기존 데이터베이스를 통한 염기서열 비교에서의 일치율 분석이 제한적일 수 밖에 없을 것으로 사료되었다. HIV subtype 분석에는 env gene 뿐 아니라 gagpol gene의 경우도 적용되기 때문에[24,25] 각기 다른 tool에서 서로 다른 subtype을 제시한 혈액에 대해서는 env gene 이외의 영역에 대한 유전자 염기서열 분석이 필요할 것으로 여겨졌다.

그 외에도 본 연구에서 염기서열 분석에 적용한 BigDye Direct cycle Sequencing kit의 경우 해상도가 제한되어 있어 일부 영역에서의 명확한 염기서열을 제시하지 못한 경우에는 Los Alamos의 HIV Blast를 비롯하여 다른 tool의 데이터베이스에서의 일치율 분석을 할 수 없었으며, NCBI 유전자 정보 분석 프로그램에서의 결과만 제시할 수 밖에 없었다. 그리고 NCBI데이터베이스와의 일치율이 낮은 경우가 다수 존재하였으며, 이 경우 보다 확실한 결과 도출을 위한 추가 위한 분석이 필요할 것으로 판단되었다. 보다 정확한 결과 분석을 위해서는 차세대 염기서열 분석 시스템(next generation sequencing)을 이용한 염기서열 분석도 고려할 필요가 있고, 특히 유전적 변이가 다양하고 빈번한 HIV에 대한 유전자 분석에는 보다 더 높은 해상도의 결과를 제시하기 위해 이의 적극적 활용이 필요할 것으로 사료되었다.

HIV의 유전자분석은 감염 경로의 추정, 검사 시약 및 치료제의 개발에 참고가 될 수 있으며, HIV 양성헌혈 혈액에 대한 분석은 국내 감염자에 대한 간접적인 지표가 될 수 있을 것으로 판단된다. 또한 저역가 감염 혈액이나 국내에서 흔히 발견되지 않는 subtype으로 나타난 양성 혈액의 경우에는 향후 검사 시약의 평가 등에 효과적인 시료가 될 수 있으므로 특별히 선별하여 장기간 보관 관리할 필요가 있을 것으로 판단하였다.

요 약
배경: 대한적십자사에서는 2005년에 혼합검체를 이용한 HIV 핵산증폭검사를 도입하였다. 그리고 2012년 6월 NAT는 개별검사로 전환되었다. 이 연구는 HIV 핵산증폭검사 양성 헌혈자에 대한 특징 분석과 더불어 10년 전후 이들 특징의 차이 존재여부를 확인하고자 수행하였다.
방법: 총 118건(2007년도 37건, 2008년도 20건, 2017년도 32건, 2018년도 29건)의 HIV NAT 양성 헌혈 혈액을 이용하혀 HIV RNA 정량값과 HIV subtype의 분포를 분석하였다.
결과: 10년 전과 후의 HIV RNA 정량값과 HIV subtype 분포의 뚜렷한 차이는 나타나지 않았다. 3건의 경우 저역가로 인하여 못하였으며, 정량값을 도출한 나머지 115건의 평균값은 5.14×104 copies/mL로 나타났다. HIV 핵산증폭검사 양성 헌혈자 중 가장 많은 분포를 보인 subtype은 54.2% (64/118)를 보인 B이었다. 5.9% (7/118)는 subtype C이었고, 47건(39.8%)의 경우 CRF형으로 나타났다.
결론: 이번 연구에서의 HIV subtype B의 비율(54.2%)이 과거 연구결과(95.2%)에 비하여 감소한 것으로 나타났다. 이는 CRF 3, 8, 9, 14, 15의 경우 subtype B를 포함하는 재조합 형태이기 때문에 과거 연구에서는 B로 판정되었을 가능성이 있을 것으로 여겨졌다.
References
  1. Perelson AS, Neumann AU, Markowitz M, Leonard JM, Ho DD. HIV-1 dynamics in vivo: virion clearance rate, infected cell life-span, and viral generation time. Science 1996;271:1582-6.
    Pubmed CrossRef
  2. Cohen OJ, Fauci AS. Transmission of multidrug-resistant human immunodeficiency virus--the wake-up call. N Engl J Med 1998;339:341-3.
    Pubmed CrossRef
  3. Bbosa N, Kaleebu P, Ssemwanga D. HIV subtype diversity worldwide. Curr Opin HIV AIDS 2019;14:153-60.
    Pubmed CrossRef
  4. Hemelaar J, Gouws E, Ghys PD, Osmanov S. Global and regional distribution of HIV-1 genetic subtypes and recombinants in 2004. AIDS 2006;20:W13-23.
    Pubmed CrossRef
  5. Los Alamos National Laboratory. HIV circulating recombinant forms (CRFs). https://www.hiv.lanl.gov/content/sequence/HIV/CRFs/CRFs.html [Online] (last visited on 20 February 2020)
  6. Sivay MV, Hudelson SE, Wang J, Agyei Y, Hamilton EL, Selin A, et al. HIV-1 diversity among young women in rural South Africa: HPTN 068. PLoS One 2018;13:e0198999.
    Pubmed KoreaMed CrossRef
  7. Sallam M, Esbjörnsson J, Baldvinsdóttir G, Indriðason H, Björnsdóttir TB, Widell A, et al. Molecular epidemiology of HIV-1 in Iceland: Early introductions, transmission dynamics and recent outbreaks among injection drug users. Infect Genet Evol 2017;49:157-63.
    Pubmed CrossRef
  8. Oster AM, Switzer WM, Hernandez AL, Saduvala N, Wertheim JO, Nwangwu-Ike N, et al. Increasing HIV-1 subtype diversity in seven states, United States, 2006-2013. Ann Epidemiol 2017;27:244-510.
    Pubmed CrossRef
  9. Castley A, Sawleshwarkar S, Varma R, Herring B, Thapa K, Dwyer D, et al. A national study of the molecular epidemiology of HIV-1 in Australia 2005-2012. PLoS One 2017;12:e0170601.
    Pubmed KoreaMed CrossRef
  10. Lima K, Leal É, Cavalcanti AMS, Salustiano DM, de Medeiros LB, da Silva SP, et al. Increase in human immunodeficiency virus 1 diversity and detection of various subtypes and recombinants in north-eastern Brazil. J Med Microbiol 2017;66:526-35.
    Pubmed CrossRef
  11. Aibekova L, Foley B, Hortelano G, Raees M, Abdraimov S, Toichuev R, et al. Molecular epidemiology of HIV-1 subtype A in former Soviet Union countries. PLoS One 2018;13:e0191891.
    Pubmed KoreaMed CrossRef
  12. Wang X, Zhang M, Li J, Li T, Sun C, Li H, et al. Genetic characterization of a unique recombinant strain identified in Yunnan with genome comprising B and C. AIDS Res Hum Retroviruses 2017;33:614-20.
    Pubmed CrossRef
  13. Chen M, Ma Y, Chen H, Dai J, Dong L, Yang C, et al. HIV-1 genetic transmission networks among men who have sex with men in Kunming, China. PLoS One 2018;13:e0196548.
    Pubmed KoreaMed CrossRef
  14. Korean Centers for Disease Control and Prevention. Molecular epidemiology of HIV in Korea. https://www.cdc.go.kr/board/board.es?mid=a20602010000&bid=0034&list_no=12203&act=view [Online] (last visited on 20 February 2020)
  15. Lee JS, Yoon MJ, Kang JW, Kim JY, Seo DH, Park Q, et al. Characteristics of human immunodeficiency virus type 1 reactive blood donors following nucleic acid amplification test screening. Korean J Blood Transfus 2007;18:202-8.
  16. Cho YJ, Kim MH, Kwon SY, Cho NS, Yoon KW, Jee YH, et al. Analysis for human immunodeficiency virus 1 subtype in Korean blood donors. Korean J Blood Transfus 2012;23:210-6.
  17. National Center for Biotechnology Information. Genotyping. https://www.ncbi.nlm.nih.gov/projects/genotyping/formpage.cgi [Online] (last visited on 20 February 2020)
  18. Oh MD, Park SW, Kim U, Kim HB, Choe YJ, Kim E, et al. Determination of genetic subtypes of HIV type 1 isolated from Korean AIDS patients. AIDS Res Hum Retroviruses 2002;18:1229-33.
    Pubmed CrossRef
  19. Los Alamos National Laboratory. HIV blast. https://www.hiv.lanl.gov/content/sequence/BASIC_BLAST/basic_blast.html [Online] (last visited on 4 March 2020)
  20. Luxembourg Institute of Health. COMET tool. https://comet.lih.lu/index.php?cat=hiv1 [Online] (last visited on 4 March 2020)
  21. Katholieke Universiteit. REGA HIV subtyping tool. https://www.genomedetective.com/app/typingtool/hiv [Online] (last visited on 4 March 2020)
  22. Kang JW, Lee JS, Yoon MJ, Hwang DH, Choi BR, Nam GY, et al. Evaluation of the performance ability of nucleic acid amplification test systems in Korean Red Cross. Korean J Blood Transfus 2007;18(S1):s151.
  23. Gen-Probe Inc. The manual of Procleix Ultrio Plus Assay. San Diego: Gen-Probe Inc.; 2012.
  24. Chow WZ, Bon AH, Keating S, Anderios F, Halim HA, Takebe Y, et al. Extensive genetic diversity of HIV-1 in incident and prevalent infections among Malaysian blood donors: multiple introductions of HIV-1 genotypes from highly prevalent countries. PLoS One 2016;11:e0161853.
    Pubmed KoreaMed CrossRef
  25. Zeng P, Liu Y, He M, Wang J, Keating S, Mao W, et al. The infection staging and profile of genotypic distribution and drug resistance mutation among the human immunodeficiency virus-1 infected blood donors from five Chinese blood centers, 2012-2014. PLoS One 2017;12:e0179328.
    Pubmed KoreaMed CrossRef

December 2020, 31 (3)
Full Text(PDF) Free

Social Network Service

Cited By Articles
  • CrossRef (0)

Author ORCID Information
Services