search for




 

Detection of RHD 1227G>A and 1222T>C Using PCR-Restriction Fragment Length Polymorphism
PCR-제한효소절편길이다형성법을 이용한 RHD 1227G>A 및 1222T>C 검출
Korean J Blood Transfus 2021;32:28−34
Published online April 30, 2021;  https://doi.org/10.17945/kjbt.2021.32.1.28
© 2021 The Korean Society of Blood Transfusion.

Wooshin Kim, M.D., Geon Park, M.D.
김우신ㆍ박 건

Department of Laboratory Medicine, College of Medicine, Chosun University, Gwangju, Korea
조선대학교 의과대학 진단검사의학교실
Geon Park, M.D.
Department of Laboratory Medicine, College of Medicine, Chosun University, 365 Pilmundae-ro, Dong-gu, Gwangju 61453, Korea
Tel: 82-62-220-3272, Fax: 82-62-232-2063, E-mail: creatgeon@chosun.ac.kr, ORCID: https://orcid.org/0000-0002-1414-7877
Received February 16, 2021; Revised March 22, 2021; Accepted March 22, 2021.
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
Background: DEL is an RhD variant that cannot be detected by routine serologic tests because of the extremely low expression of the RhD antigen. Detecting the common genotypes of RHD 1227G>A and 1222T>C in Korean DEL is important for safe and efficient blood transfusions. Therefore, in this study, a PCR-restriction enzyme fragment polymorphism (RFLP) method was applied to detect RHD 1227G>A and 1222T>C.
Methods: DNA extracted from the blood of each segment of 56 units of RhD-negative red blood cell were used. The promoter, exon 7 and exon 9 of RHD, and exon 9 of RHCE were amplified. The PCR products of RHD exon 7, RHD exon 9, and RHCE exon 9 were treated with the restriction enzymes HpyAV and MspI, and the RFLP patterns were observed by electrophoresis. The results of PCR-RFLP of RHD exon 9 were confirmed by PCR-direct sequencing.
Results: RHCE exon 9 was amplified in all 56 DNAs. RHD promoters, exon 7, and exon 9 were all amplified in 10 samples, RHD promoter, exon 7, and exon 9 were not amplified in 38 samples, and RHD promoter only was amplified in eight samples. As a result of the RHD exon 9 PCR-RFLP performed on 10 samples with all targets amplified, 10 samples were determined to be 9 samples with 1227G>A and 1 sample with 1222T>C. The PCR-RFLP result and the sequencing result were 100% identical.
Conclusion: PCR-RFLP using HpyAV and MspI is a reliable and applicable method for detecting RHD 1227G>A and 1222T>C in serologically RhD negative samples.
Keywords : RHD, DEL, Genotyping, RFLP
서 론

RhD 혈액형의 변이형은 약 D형, 부분 D형과 DEL형을 나눌 수 있다. 이 중 DEL형은 적혈구막에 표현된 D 항원이 양이 극소량으로 적어 약D검사로는 검출할 수 없으므로 흡착-용출 시험(adsorption and elution test)을 실시하여 검출한다[1]. 그러나 일부 DEL의 경우 흡착-용출 시험에도 음성이 나올 수 있어서 이와 같은 혈청학적 검사법으로 DEL을 완전하게 검출할 수 없다고 알려져 있다[2]. 이런 이유로 한국인 DEL을 검출하기 위해 분자검사를 널리 이용하고 있으며 한국인 DEL은 대부분 1227G>A와 1222T>C이므로 이를 검출하는 여러 전략과 기법이 개발되었다[1-6].

이에 저자는 기본적인 분자검사 장비만으로 실시가 가능하고 검사실에 적용이 비교적 쉬운 PCR-제한효소절편길이다형성(restriction fragment length polymorphism, RFLP)을 적용한 RHD 1227G>A와 1222T>C 검출법을 보고하고자 한다.

대상 및 방법

1. 검체 및 DNA 추출

2018년 3월부터 2020년 7월까지 수집된 RhD 음성 농축적혈구 56단위의 각 절편에서 얻은 혈액 200 μL에서 LaboPass Blood Genomic DNA Isolation Kit Mini (CosmoGeneTech, Daejeon, South Korea)를 이용하여 DNA를 추출하였다.

2. 대립유전자특이 PCR

RHD 프로모터, 엑손 7, 엑손 9와 RHCE 엑손 9를 기존에 보고되거나[7] 자체 제작한 대립유전자특이시발체(Table 1)를 이용하여 증폭하였다. 대립유전자 PCR 반응액은 2X QuestHOT Universal Master Mix (BioQuest, Seoul, Korea) 12.5 μL, DNA 2 μL, 전방 및 후방 시발체 각 5 μM 및 증류수를 첨가하여 총 25 μL가 되도록 하였다. Veriti 96-Well Thermal Cycler (Thermo Fisher Scientific, Waltham, MA, USA)를 이용하여 다음 조건으로 PCR을 진행하였다. 95℃에서 15분간 처리한 후에 95℃ 10초, 다양한 온도 10초, 72℃ 30초씩 35회 증폭하고 증폭산물 5 μL를 2% 아가로스겔에서 5 V/cm (전압/전극간 거리)로 30분간 전기영동을 실시하였다.

Primers used in this study. Base substitutions for the intentional mismatch between the primers and template DNA are denoted by lowercase letters

Name Sequences (5’-3’) Specificity Primer binding site* Amplicon size (bp) Ta (°C) Purpose References
RhDpromoterF GTATCCACTTTCCACCTCCCaGC RHD Promoter (3918..3940) 259 65 P This study
RhDpromoterR GCAGCCAACTTCCCCTGTcCT RHD Promoter (4156..4176) P This study
RhDexon7F CACAGCTCCATCATGGGCTACAA RHD Exon 7 (39137..39159) 228 65 P, R This study
RhDexon7R ATTCACCGAAGCCTACTGAGCAC RHD, RHCE Intron 7 (39342..39364) P, R This study
RhDexon9F TGAGATACTGTCGTTTTGACACACAATAcTTC RHD Intron 8 (54302..54333) 268 65 P, R, S [6]
RhDexon9R GTTTTACTCATAAACAGCAAGTCAACATATATcCT RHD Intron 9 (54535..54569) P, R, S [6]
RhCEexon9F TGAGACACTGTCGTTTTGACACACACAAgATT RHCE Intron 8 (64553..64584) 270 55 P, R This study
RhCEexon9R GTTTTACTCATAAACAGCAAGTCAACATAcATACC RHCE Intron 9 (64788..64822) P, R This study

*Numbers of primer binding sites indicate ranges of primer binding sequences according to reference sequences (accession No. RHD NG_007494.1 and RHCE NG_009208.3).

Abbreviations: Ta, annealing temperature; P, PCR; R, restriction fragment length polymorphism; S, sequencing.



3. HpyAV와 MspI을 이용한 PCR-RFLP

RHD 프로모터, 엑손 7 및 엑손 9가 모두 증폭되어 DEL이 의심되는 검체의 RHD 엑손 7와 엑손 9 그리고 RHCE 엑손 9의 각 증폭산물을 10 μL씩 두 개의 0.2 mL PCR 튜브로 나누어 분주하였다. 분주된 각 증폭산물 중 하나에는 HpyAV (NEB, ipswich, MA, USA) 2 U를, 다른 하나에는 MspI (NEB) 20 U를 첨가한 후 37℃에서 1시간 처리하고 3% 아가로스겔에서 5 V/cm으로 40분간 전기영동을 실시하였다. HpyAV의 인식부위는 5’-CCGG-3’이며 MspI의 인식부위는 5’-CCTTC-3’이다. RHD 엑손 9의 증폭산물(268 bp)은 1227G>A와 1222T>C 변이가 없는 경우 HpyAV에 의해 잘려서 167 bp와 101 bp의 절편이 관찰되고, MspI에 의해서는 잘리지 않아 268 bp 밴드가 관찰된다. 1227G>A의 경우 HpyAV 인식부위가 3’-CTTTC-5’ 로 변형되어 HpyAV에 의해 절단되지 않아 268 bp의 밴드가 관찰되고, 1222T>C의 경우 MspI 인식부위가 5’-CCGG-3’로 변형되어 MspI에 의해 절단되어 167 bp와 101 bp의 절편이 관찰된다. RHD 엑손 7의 증폭산물은 HpyAV에 의해 절단되지 않으므로 228 bp가 관찰되고 MspI에 의해 절단되어 135 bp와 93 bp가 관찰된다. RHCE 엑손 9의 증폭산물은 HpyAV에 의해 절단되어 165 bp와 105 bp의 밴드가 관찰되고 MspI에 의해서는 절단되지 않아 270 bp 밴드가 관찰된다. 이와 같이 RHD 엑손 7의 증폭산물은 HpyAV의 음성대조와 MspI의 양성대조로, RHCE 엑손 9의 증폭산물은 HpyAV의 양성대조와 MspI의 음성대조로 이용하였다.

4. 염기서열분석

PCR-RFLP를 위한 PCR 조건과 동일하게 RHD 엑손 9을 증폭하고 증폭에 이용한 시발체(Table 1)로 염기서열분석을 실시하였다. ExoSAP-ITTM PCR Product Cleanup Reagent (Thermo Fisher Scientific)로 정제 후 BigDyeTM Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific)와 ABI 3730XL (Thermo Fisher Scientific)으로 분석하였다.

결 과

1. RHD 프로모터, 엑손 7, 엑손 9 그리고 RHCE 엑손 9 증폭 결과

RHCE 엑손 9이 56개 DNA 모두(56/56, 100%)에서 증폭되었으며 RHD 프로모터, 엑손 7 및 엑손 9이 모두 증폭된 검체는 10개(10/56, 17.9%), RHD 프로모터, 엑손 7 및 엑손 9이 모두 증폭이 되지 않은 검체는 38개(38/56, 67.9%), RHD 프로모터만 증폭되었으나 엑손 7과 엑손 9은 증폭되지 않은 검체는 8개(8/56, 14.3%)였다.

2. RHD 엑손 7와 엑손 9 그리고 RHCE 엑손 9 PCR-RFLP 결과(Fig. 1)

RHD 프로모터, 엑손 7 및 엑손 9이 모두 증폭된 검체 10개 중에서 RHD 1227G>A로 판정된 검체는 9개(9/56, 16.1%)였고 RHD 1222T>C로 판정된 검체는 1개(1/56, 1.8%)였다. MspI과 HpyAV의 성능을 평가하기 위해 함께 실시한 RHD 엑손 7과 RHCE 엑손 9 PCR-RFLP 결과는 양성대조와 음성대조로서 예측한 결과와 동일하였다.

Fig. 1. PCR-RFLP patterns of RHD exon 7, RHD exon 9, and RHCE exon 9 using HpyAV and MspI. Representative results are shown for a wild RhD positive, for a DEL 1227G>A, and for a DEL 1222T>C. A weak (partial) D will show the same pattern as a wild RhD positive. Lane M, φX174 HaeIII digest (Takara, Shiga, Japan). Abbreviations: H, HpyAV; M, MspI.

3. RHD 엑손 9 PCR-RFLP 결과와 염기서열분석법 결과 비교

동일한 RHD 엑손 9 증폭산물에 대해 실시한 염기서열 결과는 100% (10/10) PCR-RFLP 결과와 동일하였다.

고 찰

한국인에서 가장 흔한 DEL 유전형인 1227G>A와 1222T>C를 검출 및 감별하는 것은 안전하고 효율적인 수혈을 위해 필요하다. 국내 수혈가이드라인(제4판)에서는 1227G>A의 경우 D 항원에 노출된 후 항-D를 유발한 사례가 보고된 적이 없어서 RhD 양성 혈액제제 수혈을 이용할 수 있다고 하였으나, Yang 등[2]은 응급상황이 아닌 경우 원칙적으로 1227G>A와 1222T>C를 포함한 모든 D 변이형 환자에게 RhD 음성 혈액제제 수혈이 권장된다고 하였다. 실제로 Choi 등[8]은 심장 이식 수술이 예정 중인 RHD 1227G>A 환자에게 RhIG와 함께 RhD 양성 성분채집혈소판 1단위를 투여하고 예정된 심장이식 시점(3개월 후)에 anti-D가 검출되지 않은 것은 확인한 후 RhIG 투여 없이 76단위의 RhD 양성 혈액제제를 수혈 후 1년 이상 추적 관찰에서 anti-D가 생성되지 않은 한 사례를 보고하면서 아시아 DEL형(RHD 1227G>A)에게는 RhD 양성 혈액제제를 비응급 상황에서도 사용하는 것을 제안하였다. 이렇듯 DEL 1227G>A의 경우 DEL 1227G>A 혈액형 여부를 알고 있으면 RhD 음성 혈액제제의 수급이 어려운 응급한 상황에서 다른 RhD 음성이나 RhD 변이형보다 더 유연하게 RhD 양성 혈액제제를 이용할 수 있는 장점이 있다.

혈청학적으로 RhD 음성인 한국인의 RHD 유전형의 종류와 각 빈도는 RHD 전체 소실 74∼75%, DEL 13∼17%, RHD-CE-D 하이브리드 9∼10%로 알려져 있다[9]. 본 연구에서 무작위로 수집된 혈청학적으로 RhD 음성인 공혈자의 56개 검체에서의 RHD 유전형은 RHD 전체 소실 67.9%, DEL 17.9%, RHD-CE-D 하이브리드 의심 14.3%였으며 기존에 보고된 결과와 유사하였다. 한국인 DEL에서 보고된 유전변이와 각 빈도는 1227G>A 16.3%, 1222T>C가 0.9%였고 711delC는 한 차례 증례보고가 있었다[6,10]. 본 연구에서 RHD 1227G>A는 16.1%였고 RHD 1222T>C 는 1.8%였으며 기존 보고와 유사하였다.

RHD 유전형 검사에서 염기서열분석법이 표준 검사법이지만 과정이 복잡하고 시간이 오래 걸리므로 PCR 기법을 응용하여 여러 전략이 개발되었다[1-6]. 이 전략들은 혈청학적 RhD 음성에서 RHD 전체 소실을 일차적으로 배제하고 DEL, RHD-CE-D 하이브리드 그리고 weak (또는 partial) D를 선별할 수 있도록 디자인되어 있으며 PCR 횟수를 줄이거나 다중(multiplex) PCR을 실시하기 위해 특정 표적만을 선택적으로 증폭한다. 본 연구에서는 RHD 전체 소실과 DEL 1227G>A 및 1222T>C를 선별 또는 검출하기 위해서 RHD 프로모터, 엑손 7와 엑손 9를 표적으로 선정하였다. Hong 등[6]의 연구에서는 RHD 엑손 9와 엑손 10을 선정하였다. RHD전체 소실에서는 RHD 프로모터와 엑손 10를 포함한 모든 RHD 표적이 증폭되지 않으므로 RHD 전체 소실을 선별하기 위해 본 연구에서는 프로모터를, Hong 등[6]의 연구에서는 엑손 10을 이용하였다. RHD-CE-D 하이브리드는 RHD 프로모터는 증폭이 되나 RHD 엑손 7과 엑손 9는 증폭되지 않는다. 야생형, weak (또는 Partial) D 그리고 RHD 1227G>A 및 1222T>C은 RHD 프로모터, 엑손 7과 엑손 9 모두 증폭된다. 본 연구에서는 대조 증폭 표적으로 RHCE 엑손 9를 이용하여 DNA의 양과 질 그리고 PCR의 성공 여부를 평가할 수 있었다.

RHD 1227G>A 및 1222T>C와 같은 단일염기변이를 검출하는 기법은 매우 많으나[11,12], 최근까지 RHD 1227G>A와 1222T>C를 검출하는데 이용된 기법은 직접염기서열분석법, 대립유전자특이PCR, 다중단일염기시발체확장반응(multiplex single-base primer extension reaction), 형광공명에너지전이(fluorescence resonance energy transfer) 소식자를 이용하는 고해상도융해곡선분석(high-resolution melting curve analysis, HRM) 등이다[5,6]. RhD 음성 공혈자에서 RHD 유전자 결실의 zygosity를 확인하기 위해 PCR-RFLP 기법을 이용한 연구가 있었으나[13], RHD 1227G>A와 1222T>C를 검출하기 위해 RFLP 기법을 이용한 것은 본 저자들이 알고 있는 한 최초 연구로 사료된다. 본 연구에서 이용한 PCR-RFLP 기법은 다른 검사 기법처럼 PCR 과정이 필요하나 특수 분자 검사 장비나 시약이 필요하지 않고 비교적 쉽게 실시할 수 있으므로 검사실에 용이하게 적용할 수 있다. 하지만 HRM 기법에 비해 상대적으로 검사 단계가 많고 검사시간이 길다[14]. 따라서 HRM을 구동할 수 있는 실시간 PCR 장비(real-time PCR instrument)를 가지고 있는 임상분자검사실에서는 HRM을 이용하면 많은 검체를 신속하게 분석할 수 있을 것이다. 현재 많은 임상분자검사실에서 실시간 PCR 장비를 가지고 있으나 HRM 소프트웨어를 별도로 구매하여 사용하는 검사실은 많지 않다. Kim 등[15]에 의하면 약 D검사에서 음성 및 RhCE 표현형 검사에서 C 항원 양성인 경우 RHD 유전형 검사를 실시할 것을 권고하고 있는데 RHD 유전형 검사의 예상 건수가 적고 HRM을 실시할 수 없는 임상검사실에서는 형광 소식자와 HRM 소프트웨어를 구매하여 HRM 기법을 시행하기 보다는 PCR-RFLP 기법을 이용하여 RHD 1227G>A와 1222T>C를 검출하는 것이 더 효율적일 것으로 생각된다.

DEL 표현형을 보이는 유전변이가 The Human RhesusBase에 현재 총 44개가 현재 등록되어 있으며[16], 이들 유전변이에는 단일염기 치환, 다중염기 치환, 단일염기 결실, 엑손 결실, 삽입, 그리고 하이브리드 등이 있다. 본 연구에서는 RHD 1227G>A와 1222T>C를 검출하는 기법을 개발하였으나 1227G>A와 1222T>C 이외에도 여러 변이에서 DEL 표현형을 보이므로 1227과 1222에서 야생형을 보인 경우에는 RHD 프로모터와 모든 엑손을 PCR-염기서열분석을 하는 것이 필요할 것으로 사료된다.

본 연구에서 혈청학적 RhD 음성 검체 56개에서 총 10개의 DEL 검체를 찾았으며 HpyAV과 MspI를 이용하여 1227G>A 9개 검체와 1222T>C 1개 검체를 찾았다. RHD 1227G>A 및 1222T>C를 검출하기 위한 HpyAV와 MspI을 이용하는 PCR-RFLP은 신뢰할 수 있고 적용가능한 검사 기법으로 사료된다.

요 약

배경: DEL은 일반적인 혈청학적 검사에서는 검출되지 않을 정도로 낮은 RhD 항원의 표현을 하는 한 RhD 변이형이다. 한국인 DEL에서 흔한 유전형인 RHD 1227G>A와 1222T>C를 검출하는 것은 안전하고 효율적인 수혈을 위해 중요하다. 이에 본 연구에서 PCR-제한효소절편길이다형성법(restriction enzyme fragment polymorphism, RFLP) 기법을 RHD 1227G>A 및 1222T>C을 검출위해 적용하였다.

방법: RhD 음성 농축적혈구제제 56 단위 각 절편의 혈액에서 추출된 DNA를 이용하였다. RHD 프로모터, 엑손 7 및 엑손 9 그리고 RHCE 엑손 9를 증폭하였다. RHD 엑손 7와 엑손 9 그리고 RHCE 엑손 9 증폭산물을 제한효소 HpyAV와 MspI으로 처리하고 RFLP 패턴을 전기영동으로 관찰하였다. PCR-직접염기서열분석으로 PCR-RFLP의 결과를 확인하였다.

결과: RHCE 엑손 9가 56개 DNA 모두 증폭되었다. RHD 프로모터, 엑손 7 및 엑손 9이 모두 증폭된 검체는 10개, RHD 프로모터, 엑손 7 및 엑손 9이 모두 증폭이 되지 않은 검체는 38개, RHD 프로모터만 증폭된 검체는 8개였다. 모든 표적이 증폭된 10개 검체에 대해 실시한 RHD 엑손 9 PCR-RFLP 결과 9개 검체는 1227G>A로, 1개 검체는 1222T>C로 판정되었다. 이 PCR-RFLP 결과와 염기서열분석의 결과는 100% 일치하였다.

결론: 혈청학적으로 RhD 음성 검체에서 HpyAV과 MspI를 이용한 PCR-RFLP는 신뢰할 수 있고 적용가능한 RHD 1227G>A 및 1222T>C을 검출할 수 있는 방법이다.

References
  1. Seo MH, Kim B, Kwon JR, Choi YS, Kim JN, Park KU, et al. Transfusion strategy and laboratory update on the DEL variant. Korean J Blood Transfus 2015;26:1-8.
    CrossRef
  2. Yang HS, Chun S, Lee SA, Kwon JR, Choi YS, Kim JN, et al. Transfusion strategy of RhD-negative/variant patients in the Korean population. Lab Med Online 2017;7:89-93.
    CrossRef
  3. Seo MH, Won EJ, Hong YJ, Chun S, Kwon JR, Choi YS, et al. An effective diagnostic strategy for accurate detection of RhD variants including Asian DEL type in apparently RhD-negative blood donors in Korea. Vox Sang 2016;111:425-30.
    Pubmed CrossRef
  4. Kim TY, Hong YJ, Kim MJ, Kim H, Kim TS, Park JS, et al. Recommendations regarding practical DEL typing strategies for serologically D-negative Asian donors. Transfus Med Hemother 2020;47:88-93.
    Pubmed KoreaMed CrossRef
  5. Chen JC, Lin TM, Chen YL, Wang YH, Jin YT, Yue CT. RHD 1227A is an important genetic marker for RhD(el) individuals. Am J Clin Pathol 2004;122:193-8.
    Pubmed CrossRef
  6. Hong YJ, Kim H, Song EY, Cho D, Park KU, Han KS. Development of real-time PCR and melting curve analysis for the rapid detection of DEL with RHD (c.1222T>C) or RHD (c.1227G>A). Clin Lab 2016;62:1995-2000.
    Pubmed CrossRef
  7. Gassner C, Doescher A, Drnovsek TD, Rozman P, Eicher NI, Legler TJ, et al. Presence of RHD in serologically D-, C/E+ individuals: a European multicenter study. Transfusion 2005;45:527-38.
    Pubmed CrossRef
  8. Choi S, Chun S, Seo JY, Yang JH, Cho D. Planned transfusion of D-positive blood components in an Asia type DEL patient: proposed modification of the Korean National Guidelines for Blood Transfusion. Ann Lab Med 2019;39:102-4.
    Pubmed KoreaMed CrossRef
  9. Kim JY, Kim SY, Kim CA, Yon GS, Park SS. Molecular characterization of D-Korean persons: development of a diagnostic strategy. Transfusion 2005;45:345-52.
    Pubmed CrossRef
  10. Ma T, Yu H, Jeon S, Cho D, Chun S, Shin MG. Case of D-variant from a frameshift mutation RHD 711delC. Korean J Blood Transfus 2019;30:168-73.
    CrossRef
  11. Ronaghi M and Langaee T. Single nucleotide polymorphisms: discovery, detection and analysis. Per Med 2005;2:111-25.
    Pubmed CrossRef
  12. Matsuda K. PCR-based detection methods for single-nucleotide polymorphism or mutation: real-time PCR and its substantial contribution toward technological refinement. Adv Clin Chem 2017;80:45-72.
    Pubmed CrossRef
  13. Matheson KA and Denomme GA. Novel 3'Rhesus box sequences confound RHD zygosity assignment. Transfusion 2002;42:645-50.
    Pubmed CrossRef
  14. Hashim HO and Al-Shuhaib MBS. Exploring the potential and limitations of PCR-RFLP and PCR-SSCP for SNP detection: a review. J Appl Biotechnol Rep 2019;6:137-44.
    CrossRef
  15. Kim TY, Hong YJ, Kim MJ, Kim H, Kim TS, Park JS, et al. Recommendations regarding practical DEL typing strategies for serologically D-negative Asian donors. Transfus Med Hemother 2020;47:88-93.
    Pubmed KoreaMed CrossRef
  16. Wagner FF and Flegel WA. The human RhesusBase, version 2.4.2. http://www.rhesusbase.info/[Online] (last visited on 15 March 2021).

 

April 2021, 32 (1)
Full Text(PDF) Free

Social Network Service

Cited By Articles
  • CrossRef (0)

Author ORCID Information

Funding Information
Services