search for




 

Comparison of the Effectiveness in the Application of Competitive and Noncompetitive Internal Control for the Laboratory Developed Polymerase Chain Reaction
실험실 자체 설계 중합효소연쇄반응을 위한 경쟁적ㆍ비경쟁적 내부품질관리물질의 적용 효과 비교
Korean J Blood Transfus 2019;30:57−64
Published online April 30, 2019;  https://doi.org/10.17945/kjbt.2019.30.1.57
© 2019 The Korean Society of Blood Transfusion.

Sunmi Shin, Jung Won Kang, Jae-won Kang, Young Ik Seo, Hyukki Min
신선미, 강정원, 강재원, 서영익, 민혁기

Blood Transfusion Research Institute, Korean Red Cross, Wonju, Korea
대한적십자사 혈액수혈연구원
Jae-won Kang Blood Transfusion Research Institute, Korean Red Cross, 50 Hyeoksin-ro, Wonju 26465, KoreaTel: 82-33-811-0216, Fax: 82-33-811-0240, E-mail: kangjaewon@redcross.or.kr, ORCID: http://orcid.org/0000-0001-9030-4494
Received November 23, 2018; Revised February 15, 2019; Accepted April 1, 2019.
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract

Background:

A nucleic acid amplification test was adopted to detect transfusion-transmitted infectious agents. In the case of HTLV, however, there was no internal control (IC) because the laboratory developed polymerase chain reaction (laboratory-developed PCR) was used. In this study, noncompetitive IC was constructed for the laboratory-developed PCR of HTLV and the effectiveness was compared with the competitive test that was constructed in a previous study.

Methods:

As a competitive IC, plasmid DNA, including the primer recognition sequence for the amplification of the HTLV pX region, was constructed. As a noncompetitive IC, an additional primer was constructed for the amplification of the housekeeping gene, the glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene. The performance of the competitive and noncompetitive IC was verified and compared using 10 HTLV positive samples and 10 negative samples. In addition, the detection limits in the assay adopting competitive IC and noncompetitive IC were compared.

Results:

In the case of competitive IC applications, all 10 positive samples were positive and all 10 negative samples were negative. In the case of noncompetitive IC applications, however, one positive sample was not detected. The detection limit of the assay using competitive IC was 100 pg and that of the assay using noncompetitive IC was 1 ng.

Conclusion:

Although the manufacturing processes is not required using noncompetitive IC, the adoption of competitive IC is more effective to ensure the assay results because the ability of detection of the assay adopting competitive IC was better than that using noncompetitive IC.

Keywords : Human T-cell lymphotropic virus, Laboratory-developed PCR, Competitive internal control, Noncom-petitive internal control
서 론

혈액을 시료로 적용하는 핵산증폭검사(nucleic acid amplification test, NAT)를 수행 시 혈액 내에 존재하는 항응고제 및 혈장 내 단백 등으로 인하여 핵산증폭반응을 저해할 수 있으며, 이로 인하여 위음성 결과를 보일 수 있다. 따라서 Interna-tional Standard Organization의 가이드라인에서는, 핵산증폭반응을 저해하는 저해제로 인한 위음성 결과의 여부를 확인하기 위하여 내부정도관리물질(International control, IC)을 채택할 것을 권고하고 있다[1]. 상용화된 검사시약의 경우 일반적으로 합성 올리고핵산염(Oligonucleotide)으로 제조된 IC가 포함되어 있으며, 검사 시 각각의 개별검체에 IC를 첨가하여 검사 결과를 보증하도록 되어있다. 그러나, 실험실에서 자체적으로 구축한 중합효소연쇄반응(laboratory developed polymerase chain reaction, laboratory-developed PCR)의 경우는 별도의 IC를 구축해야 한다. Laboratory-developed PCR에 적용하는 IC로는 유전자증폭을 위한 primer와 동일한 염기서열을 포함하는 올리고핵산염을 이용하는 경쟁적 IC와 housekeeping 유전자를 표적대상 유전자와 같이 증폭하는 비경쟁적 IC가 있다[2,3].

대한적십자사 혈액수혈연구원에서는 헌혈유보군에 대한 헌혈 보류 해제 검사에서 사용하고 있는 B형간염바이러스, C형간염바이러스 및 사람면역결핍바이러스에 대한 NAT의 경우 상용화된 검사 시약을 사용하고 있으나, 사람T림프구영양성바이러스(human T-cell lymphotropic virus, HTLV) 항체선별검사 양성자에 대한 확인검사에 적용하는 NAT의 경우는 laboratory-developed PCR을 적용하고 있어 별도의 IC 구축이 필요하였다. 본 연구진은 HTLV 표적 부위 증폭에 사용하는 primer의 염기서열을 양단에 포함하면서 증폭산물의 크기와 염기서열이 다른 재조합 플라스미드를 제작하여 이를 경쟁적 IC로 적용하고 평가한 바 있다[4]. 본 연구에서는 laboratory-developed PCR에서의 효과적인 IC 구축 및 관리를 위하여 housekeeping 유전자를 이용한 비경쟁적 IC를 구축하고, 비경쟁적 IC의 성능과 효과를 경쟁적 IC 적용 시와 비교하고자 하였다.

대상 및 방법

1. HTLV 양성 및 음성 검체

Anti-HTLV-1/2 선별검사법에서(PRISM HTLV- I/II, ABBOTT, IL, USA) 음성을 보인 검체를 음성 검체로 정의하고, 양성을 보인 경우 HTLV Blot 2.4 (MP biomedicals GmbH, Thuringia, Germany)를 이용한 웨스턴블롯 확인검사에서 양성으로 확인된 검체를 양성 검체로 정의하였다. 본 연구에서는 2017년 1월부터 6월까지 수집된 HTLV 양성 및 음성인 EDTA 전혈 검체를 각각 10개씩 확보하고, 대한적십자사 생명윤리심의위원회 및 연구용혈액수급심의를 거쳐 사용하였다(승인번호:17-4차-정-1).

2. 경쟁적 IC 및 비경쟁적 IC의 구축

경쟁적 IC는 이전 연구에서 구축한 재조합 플라스미드는 HTLV 표적부분 증폭에 사용하는 primer의 염기서열을 양단에 포함하면서 증폭산물의 크기와 내부 염기서열이 다르게 제조하였으며, 400 bp의 크기로 증폭이 될 수 있게 하였으며, 비경쟁적 IC로는 housekeeping 유전자로 glyceraldehyde-3-phosphate dehydrogenase의 유전자인 GAPDH 유전자 영역을 증폭 대상으로 설정하였고 350 bp의 크기로 증폭이 될 수 있도록 하였다[5].

3. Nested PCR의 조건

핵산추출은 MagNa pure DNA isolation kit (Roche Diagnotics GmbH, Manmheim, Germany)를 이용하였다. HTLV 유전자의 확인을 위한 증폭을 위한 primer는 Matsumoto 등[6]의 방법을 적용하여 HTLV의 pX 영역의 230 bp를 표적으로 설정하였으며, GAPDH 유전자의 증폭을 위한 primer는 Tang 등[7]의 방법 적용하여 350 bp를 표적으로 설정하였다. 각각의 primer의 염기서열은 Table 1과 같다[6,7]. 1차 PCR 반응액은 AmpliTaq Gold 360 Master mix (Applied Biosystems, CA, USA)와 external primer를 혼합하여 총 25 μL에 맞추었고, 핵산증폭은 C1000 Thermal cycler (Bio-rad, CA, USA)를, 2차 PCR 반응액은 external primer 대신에 internal primer를 사용한 것 이외에는 1차 PCR과 동일하게 진행하였다. 1, 2차 PCR 반응액은 최초 95°C에서 6분간 처리 후, 95°C에서 15초, 62°C에서 15초, 72°C에서 1분을 주기로 30회 반복하였고, 72°C에서 6분 처리 후에 반응을 종료하였다. 증폭산물의 확인을 위한 전기영동은 Lab Chip GX (Caliper Life Science, MA, USA)을 사용하였다.

Laboratory developed nested PCR primer set for HTLV and GAPDH

TargetPrimer   Sequence (5’→3’)Amplicon size (bp)
pXExternalpX1AGGGTTTGGACAGAGTCTT230
pX2AAGGACCTTGAGGGTCTTAG
InternalpX3CTTTTCGGATACCCAGTCYAC
pX4GGTTCTCTGGGTGGGGAAGGAG
GAPDHExternalGAP1AAATCAAGTGGGGCGATGCT350
GAP2GAAAGGTGGGAGCCTCAGTC
InternalGAP3AGGACCCGGGTTCATAACTG
GAP4TCCCATTCCCCAGCTCTCATA

4. 경쟁적ㆍ비경쟁적 IC의 효과 비교

HTLV 양성 및 음성인 검체 각 10개를 대상으로 HTLV의 유전자 증폭 산물과 경쟁적 IC, GAPDH가 모두 정확하게 나타나는지 확인함을 통해서 경쟁적ㆍ비경쟁적 IC의 검증을 실시하였다.

5. IC 적용 및 미적용 시의 검출한계 비교

또한 HTLV 양성 검체를 template DNA 양이 1 ng으로부터 1×10-9 ng이 되도록 1/10씩 계대 희석한 검체를 제조하여 IC 적용 및 미적용 시의 검출한계를 비교하였다.

결 과

1. 비경쟁적 IC의 검증(Fig. 1)

Fig. 1.

Electrophoresis of the PCR products of GAPDH as an internal control in the HTLV positive and negative samples. Lane 1, DNA ladder; Lane 2, HTLV positive sample without internal control; Lane 3, HTLV negative sample without internal control; Lane 4, HTLV positive sample with internal control; Lane 5, HTLV negative sample without internal control with internal control.


HTLV 양성 혈액과 음성혈액을 시료로 하여 HTLV 유전자의 pX 영역의 증폭을 위한 primer 0.5 μM와 GAPDH 유전자 증폭을 위한 primer 0.5 μM를 같이 첨가한 후 증폭반응을 한 결과, 10건 양성 혈액 검체 중 10건에서 350 bp의 GAPDH 증폭산물과 230 bp의 HTLV 유전자 증폭산물이 모두 검출되는 것을 확인하였으며, 10건 음성 혈액 검체 중 10건에서 GAPDH 증폭산물만이 검출되는 것을 확인하였다.

2. 경쟁적ㆍ비경쟁적 IC의 효과 비교(Fig. 2)

Fig. 2.

Evaluation of competitive and non-competitive Internal control with 10 HTLV positive and 10 negative samples in HTLV-nested PCR. A, 10 HTLV negative samples without any IC; B, 10 HTLV positive samples without any IC; C, 10 HTLV negative samples with competitive IC; D, 10 HTLV positive samples with competitive IC; E, 10 HTLV negative samples with noncompetitive IC; F, 10 HTLV positive samples with noncompetitive IC.


HTLV 양성 및 음성인 검체 각각 10개를 대상으로 경쟁적ㆍ비경쟁적 IC의 검증을 실시한 결과, 어느 IC도 사용하지 않은 경우와 경쟁적 IC를 사용한 경우에는 HTLV 양성 검체 10개는 모두 양성으로 음성 검체 10개는 모두 음성으로 검출하였다. 그러나 비경쟁적 IC를 사용한 검사에서는 10개의 음성검체는 모두 음성으로 검출하였으나, 양성 검체 10개 중 1개는 검출되지 않았으며, 검출된 검체에서의 밴드의 강도도 약하게 나타났다.

3. IC 적용 및 미적용 시의 검출능력 비교(Fig. 3)

Fig. 3.

Determination of the detection limit in the laboratory developed HTLV PCR with/without IC. A, PCR products of serially-diluted HTLV positive samples without any IC; B, PCR products of serially-diluted HTLV positive samples with competitive IC; C, PCR products of serially-diluted HTLV positive samples with noncompetitive IC. Lane 1, DNA ladder; Lane 2, the concentration of template DNA are 1ng; Lane 3, 100 pg; Lane 4, 10 pg; Lane 5, 1 pg; Lane 6, 100 fg; Lane7, 10 fg; Lane 8, 1 fg.


HTLV 양성검체의 계대희석을 통한 검출능력 비교 결과 어느 IC도 사용하지 않은 경우와 경쟁적 IC를 사용한 경우에는 1 ng의 농도로 희석한 검체와 100 pg의 농도로 희석한 검체에서 증폭산물의 밴드가 검출되었으며, 그 이하의 농도로 희석한 검체에서는 증폭산물의 밴드가 검출되지 않았다. 그러나, 비경쟁적 IC를 사용한 경우에는 1 ng의 농도로 희석한 검체에서만 증폭산물의 밴드가 검출되었으며, 100 pg 이하의 농도로 희석한 검체에서는 HTLV 표적유전자 증폭산물의 밴드가 나타나지 않았다.

고 찰

2009년 이후 대한적십자사 혈액검사센터에서는 혈장성분헌혈자를 제외한 모든 헌혈자에 대하여 HTLV 항체 선별검사를 실시하고 있으며, 양성 결과를 보인 경우 헌혈이 일시적으로 보류되며, 대한적십자사 혈액수혈연구원에서 웨스턴블롯에 의한 확인검사를 실시하고 있다[8]. 웨스턴블롯에서 양성 결과를 보인 경우에는 헌혈이 영구적으로 보류되며, 음성 결과를 보인 경우에는 일시적으로 유보된 상태로 존재한다. 단, 웨스턴블롯에서 미결정 결과를 보인 경우에는 laboratory- developed PCR을 이용한 핵산증폭검사를 실시하여 양성인 경우에는 영구적으로, 음성인 경우에는 일시적으로 헌혈을 보류하고 있다.

본 연구는 이에 적용하고 있는 HTLV PCR을 위한 IC로서 비경쟁적 IC를 구축하였으며, 기존에 구축한 경쟁적 IC와 성능과 효과를 비교하였다. 비경쟁적 IC로 인간유전자에서 항상 발현되는 housekeeping 유전자인 GAPDH 유전자를 표적으로 primer를 제작하여 HTLV 표적유전자와 같이 증폭하는 방법을 택하였다. 비경쟁적 IC는 경쟁적 IC와 달리 별도의 IC 제조 과정이 필요가 없으며, 증폭 단계에서 IC를 위한 별도의 primer만을 첨가해 주기 때문에, 검사 시 적용에 더 편리한 점이 있으나, 증폭 대상이 되는 병원체와 서로 다른 염기서열의 primer를 사용하기 때문에 표적유전자와 최적의 증폭반응조건을 찾는 것이 어렵고, 실시간핵산증폭검사에서는 IC가 표적의 증폭을 증명하지 못하는 경우도 있었다[9,10]. 경쟁적 IC 또한 표적유전자의 viral load가 낮은 경우 표적유전자의 증폭을 약화시킨다는 보고가 있으나[10], 많은 검사법에서 활용되고 있다[11-13]. 본 연구에서는 경쟁적 IC와 비경쟁적 IC의 도입 시의 장점과 단점을 고려하여 검사에 보다 적합한 방법을 찾고자 하였다. 비경쟁적 IC와 경쟁적 IC를 각각 적용하였을 경우를 비교하였을 때, 경쟁적 IC를 사용하였을 경우에는 병원체와 IC가 같이 검출되었으나, 비경쟁적 IC에서는 병원체가 검출되지 않았던 사례가 존재하였다. 또한 농도가 낮은 검체의 경우 비경쟁적 IC를 사용하였을 때보다 경쟁적 IC를 사용하였을 때 더 낮은 농도의 검체를 검출할 수 있었다. 따라서 경쟁적 IC와 달리 비경쟁적 IC에서는 검사 환경 및 검사자의 숙련도에 따라 IC의 효과가 제대로 나타나지 않을 가능성이 존재하여 검사 결과의 보증을 위해서는 비경쟁적 IC보다는 경쟁적 IC의 사용이 더 효과적일 것으로 사료되었다.

상용화된 검사 시약이 아닌 laboratory-developed PCR의 경우 검사 결과를 보증하기 위해서는 별도의 IC 구축 및 평가의 단계가 필요 하게 되는데, 특히 일반적인 헌혈자 선별검사에 적용하는 HBV, HCV 및 HIV에 대한 검사 이외의 특정 수혈매개가능 신종감염병 병원체의 확산으로 인한 헌혈자에서의 신규 검사 필요 시 검사 시약에 대한 평가와 더불어 이러한 IC에 대한 평가 체계도 갖추어야 할 것으로 판단되었다.

요약

배경:수혈감염성 병원체를 검출하기 위해 핵산증폭검사법을 이용하고 있다. 하지만 HTLV의 경우 실험실에서 자체 설계한 중합효소연쇄반응법을 적용하고 있어 internal control (IC)이 포함되어 있지 않다. 이에 본 연구에서는 HTLV 자체 설계 중합효소연쇄반응법에 사용하기 위한 비경쟁적 IC를 제조하여 그 효과를 기존 경쟁적 IC와 비교하고자 하였다.

방법:경쟁적 내부정도관리물질로 HTLV의 pX 영역 증폭에 사용하는 primer 인식 부위를 포함하는 플라스미드 DNA를 제조하였다. 비경쟁적 IC로 housekeeping 유전자인 glyceraldehyde 3-phosphate dehydrogenase (GAPDH) 유전자 증폭을 위한 추가 primer를 구축하였다. HTLV 양성 및 음성 검체 각각 10개를 이용하여 경쟁적 IC 및 비경쟁적 IC의 효과를 검증 및 비교하였다. 그리고 경쟁적 IC와 비경쟁적 IC를 사용한 검사에서의 검출 한계를 비교하였다.

결과:경쟁적 IC를 적용한 경우에는 10개의 양성 검체는 모두 양성으로, 10개의 음성 검체는 모두 음성으로 검출하였다. 그러나, 비경쟁적 IC를 적용한 경우에는 양성검체 1개를 검출하지 못했다. IC를 적용하지 않는 경우 100 pg까지 검출하였으나, 비경쟁적 IC를 사용한 경우 1 ng까지만 검출하였다.

결론:비경쟁적 IC의 경우 제조 과정이 필요하지 않으나, 경쟁적 IC를 적용한 검사의 검출 능력이 비경쟁적 IC를 적용한 검사보다 우수하므로, 검사결과 보증을 위해서는 경쟁적 IC가 더 효과적일 것으로 사료되었다.

References
  1. Hoorfar J, Malorny B, Abdulmawjood A, Cook N, Wagner M, Fach P. Practical considerations in design of internal amplification controls for diagnostic PCR assays. J Clin Microbiol 2004;42:1863-8.
    Pubmed KoreaMed CrossRef
  2. Murphy NM, McLauchlin J, Ohai C, Grant KA. Construction and evaluation of a microbi-ological positive process internal control for PCR-based examination of food samples for Listeria monocytogenes and Salmonella enterica. Int J Food Microbiol 2007;120:110-9.
    Pubmed CrossRef
  3. Sohni Y, Kanjilal S, Kapur V. Cloning and development of synthetic internal amplifica-tion control for Bacillus anthracis real-time poly-merase chain reaction assays. Diagn Microbiol Infect Dis 2008;61:471-5.
    Pubmed CrossRef
  4. Kang JW, Shin SM, Kang JW, Seo YI, Min HK, Huh K. Construction and application of inter-nal control for laboratory-developed HTLV PCR. Korean J Blood Transfus 2018;29:33-40.
    CrossRef
  5. Bas A, Forsberg G, Hammarström S, Hammar-ström ML. Utility of the housekeeping genes 18S rRNA, beta-actin and glyceraldehyde-3- phosphate-dehydrogenase for normalization in real-time quantitative reverse transcriptase- polymerase chain reaction analysis of gene expression in human T lymphocytes. Scand J Immunol 2004;59:566-73.
    Pubmed CrossRef
  6. Matsumoto C, Mitsunaga S, Oguchi T, Mitomi Y, Shimada T, Ichikawa A et al. Detection of human T-cell leukemia virus type I (HTLV-I) provirus in an infected cell line and in peripheral mononuclear cells of blood donors by the nested double polymerase chain reac-tion method: comparison with HTLV-I anti-body tests. J Virol 1990;64:5290-4.
    Pubmed KoreaMed
  7. Tang Y, Zhang Y, Chen Y, Xiang Y, Xie Y. Role of the microRNA, miR-206, and its target PIK3C2? in endothelial progenitor cell func-tion –potential link with coronary artery dis-ease. FEBS J 2015;282:3758-72.
    Pubmed CrossRef
  8. Youn KW, Kang JW, Kwon SY, Oh DJ. Con-sideration of the improvement of the confir-matory assay for the Anti-HTLV positive blood donation. Korean J Blood Transfus 2015;26:300-8.
    CrossRef
  9. Rosenstraus M, Wang Z, Chang SY, DeBonville D, Spadoro JP. An internal control for routine diagnostic PCR: design, properties, and effect on clinical performance. J Clin Microbiol 1998;36:191-7.
    Pubmed KoreaMed
  10. Zambenedetti MR, Pavoni DP, Dallabona AC, Dominguez AC, Poersch CO, Fragoso SP et al. Internal control for real-time polymerase chain reaction based on MS2 bacteriophage for RNA viruses diagnostics. Mem Inst Oswaldo Cruz 2017;112:339-47.
    Pubmed KoreaMed CrossRef
  11. Sharma N, Chand D, Shukla A, Singh M, Govil RK, Bihari B et al. Internal controls for the quality assessment of polymerase chain reaction methods for the diagnosis of infect-ious &autoimmune diseases. Sch J Appl Med Sci 2014;2:485-8.
  12. Stöcher M, Berg J. Internal control DNA for PCR assays introduced into lambda phage particles exhibits nuclease resistance. Clin Chem 2004;50:2163-6.
    Pubmed CrossRef
  13. Villanova GV, Gardiol D, Taborda MA, Reggiardo V, Tanno H, Rivadeneira ED et al. Strategic approach to produce low-cost, effi-cient, and stable competitive internal controls for detection of RNA viruses by use of reverse transcription-PCR. J Clin Microbiol 2007;45:3555-63.
    Pubmed KoreaMed CrossRef

 

April 2019, 30 (1)
Full Text(PDF) Free

Social Network Service

Cited By Articles
  • CrossRef (0)

Author ORCID Information
Services