search for




 

Construction and Application of Internal Control for Laboratory-Developed HTLV PCR
실험실에서 자체 설계한 HTLV PCR에서의 내부정도관리물질 제조 및 적용
Korean J Blood Transfus 2018;29:33−40
Published online April 30, 2018;  https://doi.org/10.17945/kjbt.2018.29.1.33
© 2018 The Korean Society of Blood Transfusion.

Jungwon Kang1, Sun-Mi Shin1, Jae-Won Kang1, Young Ik Seo1, Hyukki Min1, and Kwang Huh2
강정원1, 신선미1, 강재원1, 서영익1, 민혁기1, 허광2

1Blood Transfusion Research Institute, Korean Red Cross, Wonju, Korea,
2Nambu Blood Laboratory Center, Korean Red Cross, Busan, Korea
1대한적십자사 혈액수혈연구원,
2대한적십자사 남부혈액검사센터
Jae-Won Kang Blood Transfusion Research Institute, Korean Red Cross, 50 Hyeoksin-ro, Wonju 26465, Korea Tel: 82-33-811-0231, Fax: 82-33-811-0240, E-mail: kangjaewon@redcross.or.kr, ORCID: http://orcid.org/0000-0001-9030-4494
Received February 9, 2018; Revised March 23, 2018; Accepted April 2, 2018.
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract

Background:

For donor samples showing reactive results in a human T-cell lymphotropic virus (HTLV) antibody test along with indeterminate results in Western blot assay, HTLV nucleic acid amplification test using laboratory-developed polymerase chain reaction (PCR) was performed. It is necessary to construct an adequate internal control (IC) to evaluate the accuracy of the results since we did not use an IC in the laboratory-developed PCR.

Methods:

As a competitive IC, plasmid DNA containing the primer recognition sequence for amplification of the HTLV pX region was constructed. We determined the adequate concentration of the IC, which was added to the samples to evaluate the accuracy of the test results.

Results:

When the plasmid DNA was added to the HTLV-positive samples, the amplified product of IC (400 bp) was detected with the HTLV gene (230 bp). The adequate concentration of plasmid DNA added as an IC was 1 pg.

Conclusion:

The construction of plasmid DNA as a competitive IC is an efficient method to evaluate accuracy of the test results. However, the production process for the competitive IC must be further developed. Therefore, it is necessary to compare with the performance of a non-competitive IC.

Keywords : HTLV, Laboratory-developed PCR, Internal control
서론

대한적십자사에서는 2009년 4월부터 혈장성분헌혈자를 제외한 모든 헌혈자에 대하여 사람 T림프구영양성바이러스(human T-cell lymphotropic virus, HTLV)에 대한 선별검사를 실시하고 있다. 선별검사는 화학발광면역법을 이용한 HTLV-I/II 항체검사(HTLV-I/II antibody, anti-HTLV-I/II)를 실시하며, anti-HTLV-I/II에서 양성 결과를 보인 경우 웨스턴블롯에 의한 확인검사를 실시하고 있다[1]. 웨스턴블롯 결과 양성을 보인 경우 헌혈이 영구적으로 보류되며, 음성을 보인 경우에는 6개월 이상 경과 후 선별검사에 적용한 방법과 동일한 방법의 anti-HTLV-I/II를 실시하여 그 결과에 따라 헌혈 가능 여부가 결정된다. 2015년까지는 확인검사로 핵산증폭검사도 같이 실시하였으나, 그 동안의 검사 결과 및 운영상의 효율성을 고려하여[2] 2016년부터는 웨스턴블롯 미결정 결과를 보인 경우에만 핵산증폭검사를 실시하고 있다. 이 검사에서 양성 결과를 보일 경우에는 헌혈이 영구 보류, 음성일 경우에는 이후 안전성검사 결과에 따라 헌혈 가능 여부가 결정된다.

혈액을 시료로 하는 핵산증폭검사 시 혈액 내에 존재하는 물질 중 항응고제로 사용되는 EDTA 또는 heparin, 적혈구의 hemoglobin, 혈장에 포함된 IgG, lactoterrin 등이 핵산증폭반응을 저해하는 저해제로 작용할 가능성이 있다[3-9]. 이들이 저해제로 작용할 경우 양성 검체임에도 불구하고 불완전한 반응으로 인한 위음성 결과를 보일 가능성이 있다. 따라서 international standard organization의 가이드라인에서는 이들 저해제로 인한 위음성 결과의 여부를 확인하기 위하여 내부정도관리물질(internal control, IC)을 채택할 것을 권고하고 있다[10]. 현재 HBV, HCV 및 HIV에 대한 헌혈자 선별검사에 적용하는 핵산증폭검사의 경우에는 상용화된 검사 시약을 사용하고 있으며, 이에는 합성 oligonucleotide로 제조된 IC가 포함되어 있어, 검사 시 각각의 개별 검체에 IC를 첨가하도록 되어 있으며, 음성결과를 보일 경우 IC에 대한 값이 양성이어야 유효한 것으로 판정된다[11].

HTLV 검사를 위한 핵산증폭검사는 현재 공인기관의 인가를 받은 상용화 시약이 존재하지 않아, 현재 HTLV 헌혈자 선별검사 양성 검체에 대한 확인검사로 적용하고 있는 핵산증폭검사는 실험실에서 자체적으로 설계한 중합효소연쇄반응(laboratory developed polymerase chain reaction, laboratory-developed PCR)에 의한 방법을 채택하고 있다. 따라서, 상용화된 검사 시약에 일반적으로 포함되어 있는 IC를 사용하고 있지 않기 때문에, 음성 결과의 경우 병원체 미존재로 인한 음성 결과인지, 불완전한 반응으로 인한 음성 결과인지에 대한 검증이 부족하다고 여겨질 수 있다. 이에 본 연구에서는 laboratory-developed PCR에 적용이 가능한 IC를 제조하였으며, 이의 적용 가능성과 적절한 적용 방법을 검토하였다.

재료 및 방법

1. HTLV 양성 및 음성검체

본 연구에 사용된 검체는 대한적십자사 혈액검사센터로부터 본원으로 확인검사가 의뢰된 헌혈자 전혈 검체 중 양성으로 판정된 검체와 음성으로 판정된 검체를 대한적십자사 혈액관리본부의 생명윤리심의위원회를 득한 후 사용하였다.

2. HTLV Nested PCR의 조건

핵산 추출은 MagNa Pure DNA isolation kit (Roche Diagnostics GmbH, Mannheim, Germany)를 이용하였으며, HTLV 감염의 확인을 위한 유전자 증폭은 Matsumoto C 등의 방법을 적용하여 HTLV의 pX 영역의 230 bp를 표적으로 한 nested PCR을 채용하였으며, 이에 사용한 primer는 Table 1과 같다[12]. 1차 PCR 반응액은 AmpliTaq Gold 360 Master Mix (Applied Biosystems, CA, USA)와 external primer set (Bioneer, Deajeon, Korea)을 사용하여 총 25 μL에 맞추었고, 핵산증폭은 C1000 Thermal cycler (Bio-rad, CA, USA)를 이용하여 95°C에서 2분간 변성 시킨 후 95°C 에서 30초, 61°C에서 30초, 72°C에서 1분으로 30회 반복 후 72°C에서 5분간 항온하였다. 2차 PCR 반응액은 external primer set 대신에 internal primer set를 사용한 것 이외에는 1차 PCR과 동일하게 진행하였다. 증폭산물의 확인을 위한 전기영동은 Lab Chip GX (Caliper Life Science, MA, USA)을 이용하였다.

HTLV-I in laboratory-developed PCR (nested PCR) primer set

Target Primer    Sequence (5’→3’)Amplicon size (bp)
ExternalpX1AGGGTTTGGACAGAGTCTT
pX2AAGGACCTTGAGGGTCTTAG
InternalpX3CTTTTCGGATACCCAGTCYAC230
pX4GGTTCTCTGGGTGGGGAAGGAG 

3. IC의 제조

IC는 Fig. 1과 같이 HTLV 표적 부위 증폭에 사용하는 primer 염기서열을 양단에 포함하면서 증폭산물의 크기와 내부의 염기서열이 다른 재조합 플라스미드를 제조하였다. pX1과 pX2를 이용한 external fragment는 600 bp, pX3과 pX4를 이용한 internal fragment는 400 bp가 되도록 pBHA 플라스미드에 삽입하였다.

Fig. 1.

Internal control for the determination of HTLV.


4. IC 적용을 위한 최적 조건 확인

IC 적용을 위한 최적 조건 확인은 Abdulmawjood A 등의 방법을 적용하였다[13]. HTLV 양성 전혈검체의 핵산을 추출하여 ND-1000 Spectrophotometer (NanoDrop Technologies, DE, USA)를 이용하여 정량하였다. 양성검체의 핵산은 50 ng/μL로 조정하여, 1/10로 계대 희석한 후, PCR 반응 시 희석한 DNA를 2 μL씩 처리하여 각각의 DNA양이 100 ng, 10 ng, 1 ng, 0.1 ng, 0.01 ng이 되도록 하였다. 이에 IC의 농도를 마찬가지로 200 ng/μL stock을 50 ng/μL로 조정하여, 1/10로 계대 희석한 후, 2 μL씩 처리하여 각각의 IC양이 100 ng, 10 ng, 1 ng, 0.1 ng, 0.01 ng, 0.001 ng, 0.0001 ng이 되도록 조절한 후 첨가하여 HTLV의 유전자 증폭 산물과 IC가 모두 정확하게 나타나는 농도를 설정하였다.

5. IC 적용 및 미적용 시의 HTLV PCR 검출한계 농도 확인

HTLV PCR 검출한계 농도를 확인하기 위해서 HTLV 양성 검체의 핵산을 0.5 ng/μL로 조정하여, 1/10씩 계대 희석한 후, PCR 반응 시 희석한 DNA를 2 μL씩 처리하여 각각의 template DNA양이 1 ng 부터 1×10–9 ng 이 되도록 하여 HTLV nested PCR을 수행하였다.

결과

1. 재조합 플라스미드의 확인

제조된 재조합 플라스미드에 대하여 nested PCR 실시 결과 400 bp의 최종 증폭산물이 확인되어, HTLV 유전자 증폭 시 사용되는 primer 인식 부위를 포함하면서 크기가 다른 유전자 증폭산물이 포함된 플라스미드 DNA가 적합하게 제조되었음을 확인하였다(Fig. 2).

Fig. 2.

Electrophoresis of PCR product of plasmid DNA as an internal control. Lane M, DNA ladder; Lane 1, Amplified product of plasmid DNA for internal control


2. IC 효과 확인

HTLV 양성 및 음성 검체에 플라스미드 DNA를 첨가 후 증폭반응을 한 결과 양성검체에서는 400 bp의 플라스미드 증폭산물과 230 bp의 HTLV 유전자 증폭산물이 검출되고, 음성검체에서는 플라스미드의 증폭산물만 검출되어 제조된 플라스미드 DNA가 IC로서의 역할을 할 수 있음을 확인하였다(Fig. 3).

Fig. 3.

Electrophoresis of PCR product of plasmid DNA as an internal control in the HTLV positive andnegative sample. Lane M, DNA ladder; Lane 1, HTLV positive sample without internal control; Lane 2, HTLV negative sample without internal control; Lane 3, HTLV positive sample with internal control; Lane 4, HTLV negative sample with internal control.


3. 적정 IC 첨가 농도 확인

HTLV PCR 양성 검체와 내부정도관리물질을 각각 계대희석하여 혼합한 검체에 대한 증폭반응 결과 양성검체 및 내부정도관리물질이 모두 정확하게 검출되는 농도는 내부정도관리물질의 농도가 1 pg일 때로 나타났다(Fig. 4).

Fig. 4.

Determination of adequate concentration of plasmid DNA for the application of internal control in HTLV nested PCR. Lane M, DNA ladder; Lane 1, 100 ng of plasmid DNA addition; Lane 2, 10 ng of plasmid DNA addition; Lane 3, 1 ng of plasmid DNA addition; Lane 4, 100 pg of plasmid DNA addition; Lane 5, 10 pg of plasmid DNA addition; Lane 6, 1 pg of plasmid DNA addition


4. IC 적용 및 미적용 시의 HTLV PCR 검출한계 농도 확인

HTLV PCR 검출한계 농도를 확인하기 위해서 HTLV 양성 전혈검체의 DNA를 ND-1000 Spectrophotometer (NanoDrop Technologies, DE, USA)를 이용하여 정량하였다. 양성 검체의 핵산은 0.5 ng/μL로 조정하여, 1/10씩 계대 희석한 후, PCR 반응 시 희석한 DNA를 2 μL씩 처리하여 각각의 template DNA양이 1 ng부터 1×10–9 ng이 되도록 하여 HTLV nested PCR을 수행하였다. 그 결과 0.1 ng이 검출한계 농도인 것으로 나타났으며, 해당농도에서 IC를 적용할 때도 양성인 결과를 나타냈다(Fig. 5).

Fig. 5.

Determination of detection limit in the laboratory developed HTLV PCR with IC and without IC.


(A) Electrophoresis of PCR products of HTLV positive samples which were amplified with IC. (B) Electrophoresis of PCR products of HTLV positive samples which were amplified without IC. Lane M, DNA ladder; Lane 1, PCR product of 1 ng of template DNA; Lane 2, PCR product of 1×10–1 ng of template DNA; Lane 3, PCR product of 1×10–2 ng of template DNA; Lane 4, PCR product of 1×10–3 ng of template DNA; Lane 5, PCR product of 1×10–4 ng of template DNA; Lane 6, PCR product of 1× 10–5 ng of template DNA; Lane 7, PCR product of 1×10–6 ng of template DNA; Lane 8, PCR product of 1×10–7 ng of template DNA; Lane 9, PCR product of 1×10–8 ng of template DNA; Lane 10, PCR product of 1×10–9 ng of template DNA. Abbreviation: IC, internal control.

결론

본 연구는 본원에서 자체적으로 설계하여 실시하고 있는 HTLV nested PCR에 적용이 가능한 IC의 제조를 위하여 HTLV 유전자 증폭에 사용되는 primer와 동일한 염기서열을 포함하면서 증폭산물의 크기가 다른 재조합 플라스미드를 제조하여 이를 검체에 첨가 후 표적이 되는 병원체와 같이 증폭이 될 수 있도록 하였다. 따라서 IC의 증폭이 없는 경우에는 음성 결과라 할지라도 증폭 반응의 불완전으로 인한 음성 결과임을 알 수 있도록 하였다.

병원체 검출을 위한 핵산증폭검사 시 상용화된 검사 시약의 경우는 IC가 포함되어 있으나, 실험실 또는 검사실에서 자체적으로 설계한 PCR의 경우는 IC를 적용하지 않는 경우가 많다. 그러나 검사 결과의 보증, 특히 음성 검체에 대한 검증을 위하여는 실험실에서 자체 설계한 PCR이라 하더라도 IC의 적용이 필요하다. 이러한 PCR로의 적용을 위한 IC로는 본 연구에서 제작한 것과 같이 표적이 되는 유전자의 증폭을 위한 primer와 동일한 염기서열을 포함하는 합성 oligonucleotie를 이용하는 competitive IC와 universal 또는 housekeeping gene을 표적 대상 유전자와 같이 증폭을 하는 noncompetitive IC가 있다[14,15]. 일반적으로 사용하는 noncompetitive IC는 beta-2-microglobulin, Glyceraldehyde 3-phosphate dehydrogenase, 18S ribosomal RNA 또는 albumin을 coding하는 house-keeping 유전자 영역을 증폭 대상으로 하며 별도의 IC제조를 위한 단계가 필요하지 않다는 장점이 있다[16]. 그러나 Noncompetitive IC는 서로 다른 염기서열의 primer를 첨가하여 증폭반응을 일으키기 때문에 이로 인한 간섭 반응과 비특이적 반응이 발생할 수 있는 문제점이 있다[10,17]. Competitive IC의 농도가 높을 경우 표적이 되는 병원체 유전자의 증폭을 위하여 결합하여야 하는 primer가 IC에 주로 결합하여 결과적으로 표적이 되는 병원체 유전자의 증폭을 방해할 수 있기 때문에[17] competitive IC를 적용할 경우 적절한 IC 첨가 농도를 설정해 주어야 하며, 본 연구에서도 IC를 100 ng 첨가했을 때에는 HTLV 양성검체에서도 HTLV 유전자의 증폭 산물을 확인할 수 없었고, 0.1 ng 정도 첨가하였을 때에 IC와 HTLV 유전자가 모두 증폭됨을 확인하였다. 효과적인 운영을 위해서는 noncompetitive IC에 대한 적용 효과의 비교가 필요할 것으로 사료되었다.

일반적인 헌혈자 선별검사로 적용하는 HBV, HCV 및 HIV에 대한 핵산증폭검사의 경우 공인기관의 인증을 받은 상용화 시약이 존재하며, 검사 결과를 보증할 수 있는 체계가 갖추어져 있지만, 일부 국가 또는 기관에서 적용하는 병원체 유전자 검사의 경우에는 대부분 실험실 내에서 설계하여 적용하여야 할 때가 많다. 특히 수혈매개 가능 신종감염병 병원체에 대한 유전자검사 필요 시에는 대부분 실험실에서 자체적으로 설계한 방법을 활용해야 될 경우가 많을 것으로 사료되었다. 이러한 경우에도 검사 결과의 보증을 위한 체계 구비를 위하여 이와 같은 IC의 적용을 고려할 수 있을 것으로 판단되었다.

요약

배경: HTLV 항체 선별검사에서 양성 결과를 보이면서 웨스턴블롯에서 미결정 결과를 보인 헌혈자 검체에 대하여 자체적으로 설계한 연쇄중합효소반응(PCR)을 이용하여 HTLV 핵산증폭검사를 실시하고 있다. 그러나 자체 설계한 PCR에서는 내부정도관리물질을 사용하고 있지 않아, 검사 결과를 보증할 수 있는 내부정도관리물질의 구축이 필요한 것으로 판단되었다.

방법: 경쟁적 내부정도관리물질로 HTLV의 pX 영역 증폭에 사용하는 primer 인식 부위를 포함하는 플라스미드 DNA를 제조하였다. 그리고 검사 결과의 보증을 위하여 검체에 첨가되는 내부정도관리물질의 적절한 농도를 설정하였다.

결과: 플라스미드 DNA를 HTLV 양성 검체에 첨가 시, 400 bp의 내부정도관리물질 증폭산물이 230 bp의 HTLV 유전자와 같이 검출되었다. 내부정도관리물질로서의 플라스미드 DNA의 적절한 첨가 농도는 1 pg으로 나타났다.

결론: 경쟁적 내부정도관리물질로서의 플라스미드 DNA의 제조는 검사 결과 보증에 효과적인 것으로 여겨졌다. 그러나 경쟁적 내부정도관리물질의 경우 별도의 제조 과정을 거쳐야 하므로, 별도의 제조 과정이 필요 없는 비경쟁적 내부정도관리물질의 성능과 비교할 필요도 있을 것으로 사료되었다.

References
  1. Kwon SY, Lim AH, Park JY, Han SH, and Cho NS. Seroprevalence of human T-lymphotropic virus type 1 and 2 in Korean blood donors. J Med Virol 2008;80:1864-7.
    Pubmed CrossRef
  2. Youn KW, Kang JW, Kwon SY, and Oh DJ. Consideration of the improvement of the confirmatory assay for the anti-HTLV positive blood donation. Korean J Blood Transfus 2015;26:300-8.
    CrossRef
  3. Promega corporation. An introduction to PCR inhibitors. https://www.promega.es/-/media/files/resources/profiles-in-dna/1001/an-introduction-to-pcr-inhibitors.pdf?la=es-es [Online] (last visited on 23 March 2018)
  4. Pallen MJ, Puckey LH, and Wren BW. A rapid, simple method for detecting PCR failure. PCR Methods Appl 1992;2:91-2.
    Pubmed CrossRef
  5. Al-Soud WA, and Rådström P. Purification and characterization of PCR-inhibitory components in blood cells. J Clin Microbiol 2001;39:485-93.
    Pubmed KoreaMed CrossRef
  6. Beutler E, Gelbart T, and Kuhl W. Interference of heparin with the polymerase chain reaction. Biotechniques 1990;9:166.
    Pubmed
  7. Holodniy M, Kim S, Katzenstein D, Konrad M, Groves E, and Merigan TC. Inhibition of human immunodeficiency virus gene amplification by heparin. J Clin Microbiol 1991;29:676-9.
    Pubmed KoreaMed
  8. Ijzerman MM, Dahling DR, and Fout GS. A method to remove environmental inhibitors prior to the detection of waterborne enteric viruses by reverse transcription-polymerase chain reaction. J Virol Methods 1997;63:145-53.
    CrossRef
  9. Kreader CA. Relief of amplification inhibition in PCR with bovine serum albumin or T4 gene 32 protein. Appl Environ Microbiol 1996;62:1102-6.
    Pubmed KoreaMed
  10. Hoorfar J, Malorny B, Abdulmawjood A, Cook N, Wagner M, and Fach P. Practical considerations in design of internal amplification controls for diagnostic PCR assays. J Clin Microbiol 2004;42:1863-8.
    Pubmed KoreaMed CrossRef
  11. U.S. Food and Drug Administration. Procleix Ultrio Plus assay. https://www.fda.gov/downloads/scienceresearch/fieldscience/ucm092120 [Online] (last visited on 23 March 2018)
  12. Matsumoto C, Mitsunaga S, Oguchi T, Mitomi Y, Shimada T, and Ichikawa A et al. Detection of human T-cell leukemia virus type I (HTLV-I) provirus in an infected cell line and in peripheral mononuclear cells of blood donors by the nested double polymerase chain reaction method: comparison with HTLV-I antibody tests. J Virol 1990;64:5290-4.
    Pubmed KoreaMed
  13. Abdulmawjood A, Roth S, and Bülte M. Two methods for construction of internal amplification controls for the detection of Escherichia coli O157 by polymerase chain reaction. Mol Cell Probes 2002;16:335-9.
    Pubmed CrossRef
  14. Murphy NM, McLauchlin J, Ohai C, and Grant KA. Construction and evaluation of a microbiological positive process internal control for PCR-based examination of food samples for Listeria monocytogenes and Salmonella enterica. Int J Food Microbiol 2007;120:110-9.
    Pubmed CrossRef
  15. Sohni Y, Kanjilal S, and Kapur V. Cloning and development of synthetic internal amplification control for Bacillus anthracis real-time polymerase chain reaction assays. Diagn Microbiol Infect Dis 2008;61:471-5.
    Pubmed CrossRef
  16. Ullmannová V, and Haskovec C. The use of housekeeping genes (HKG) as an internal control for the detection of gene expression by quantitative real-time RT-PCR. Folia Biol (Praha) 2003;49:211-6.
  17. Majidzadeh K, Mohseni A, and Soleimani M. Construction and evaluation of a novel internal positive control (IPC) for detection of coxiella burnetii by PCR. Jundishapur J Microbiol 2014;7:e8849.
    Pubmed KoreaMed CrossRef

 

August 2018, 29 (2)
Full Text(PDF) Free

Social Network Service

Cited By Articles
  • CrossRef (0)

Author ORCID Information
Services