search for




 

Rare ABO Allele Encoding Glycosyltransferase with Dual Specificity Found in a Cambodian Individual with the A2B Phenotype
A2B 표현형을 가진 캄보디아인에서 발견된 이중 특이성을 갖는 당전이효소를 부호화하는 희귀한 ABO 대립 유전자
Korean J Blood Transfus 2020;31:254−259
Published online December 31, 2020;  https://doi.org/10.17945/kjbt.2020.31.3.254
© 2020 The Korean Society of Blood Transfusion.

HongBi Yu, B.S.1, Yoo Na Chung, M.D.2, Tae Yeul Kim, M.D.2, Eunsang Suh, M.D.2, Kwang Mo Choi, M.T.2, Duck Cho, M.D.1,2
유홍비1ㆍ정유나2ㆍ김태열2ㆍ서은상2ㆍ최광모2ㆍ조 덕1,2

Department of Health Sciences and Technology, SAIHST, Sungkyunkwan University1, Seoul; Department of Laboratory Medicine and Genetics, Samsung Medical Center, Sungkyunkwan University School of Medicine2, Seoul, Korea
성균관대학교 삼성융합의과학원 융합의과학과1, 성균관대학교 의과대학 삼성서울병원 진단검사의학과2
Duck Cho, M.D.
Department of Laboratory Medicine and Genetics, Samsung Medical Center, Sungkyunkwan University School of Medicine, 81 Irwon-ro, Gangnam-gu, Seoul 06351, Korea
Tel: 82-2-3410-2403, Fax: 82-2-3410-2719, E-mail: duck.cho@skku.edu, ORCID: https://orcid.org/0000-0001-6861-3282
Received July 19, 2020; Revised July 31, 2020; Accepted August 10, 2020.
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
Cis-AB and B(A) alleles encode an ABO enzyme with dual A and B glycosyltransferase activity. Although globally rare, the cis-AB phenotype is found relatively often in Korean, Japanese, and Chinese populations. Cases of the B(A) allele have been reported mostly in the Chinese population. Forward typing performed in a Cambodian woman with an ABO discrepancy demonstrated a strong reaction with anti-A and anti-B reagents, while there was no reaction with lectin anti-A1. The anti-A1 antibody was detected in reverse typing. Through ABO gene sequence analyses of exons 6 and 7, one of the alleles was identified as ABO*B.01. In contrast, the other allele harboring a c.803G>C substitution was either ABO*cisAB.05 or ABO*BA.06 allele. The ABO*cisAB.05 and ABO*BA.06 alleles remain indistinguishable despite routine serological testing and ABO genotyping. To the best of the author’s knowledge, this is the first case report of these variants discovered in a Cambodian individual residing in Korea.
Keywords : ABO, Genotyping, cis-AB, B(A)
Introduction

The ABO gene encodes a glycosyltransferase, which catalyzes the transfer of carbohydrates to the H antigen, thereby converting the H antigen into A or B antigens, depending on the encoding allele. The common ABO phenotypes in Korea are mostly encoded by ABO*A1.02, ABO*B.01, ABO*O.01.01, and ABO* O.01.02 alleles, whereas weak ABO phenotypes are encoded by other ABO subgroup alleles, such as ABO*cisAB.01, ABO*A2.01, ABO*A2.04, ABO*B3.03, ABO*B3.06, and Aw10 [1-3]. Among ABO subgroup alleles, the B(A) and cis-AB alleles can encode an enzyme with both A and B glycosyltransferase activities [4]. This dual enzymatic activity of cis-AB results in a typical phenotype of A2B3 expressing decreased levels of A and B antigens; B(A), on the other hand, is distinguished by very low A antigen levels and normal B antigen levels.

The cis-AB is relatively common in the Korean, Japanese, and Chinese populations. To date, several cis-AB alleles such as ABO*cisAB.01, ABO*cisAB.04, and ABO*cisAB.09 have been reported in Koreans [1,5,6]. However, ABO*cisAB.05 alleles remain unexplored outside the Chinese population. In contrast to cis-AB alleles, B(A) alleles have not been identified by molecular genetic testing in Koreans and Japanese despite their abundance in Chinese. Finally, no cases of cis-AB and B(A) alleles have been yet reported in Cambodians.

Here, we report for the first time, a case of a Cambodian individual suspected of having an ABO* cisAB.05 or ABO*BA.06 allele.

Case Report

A peripheral blood sample from a 25-year-old Cambodian woman with an ABO discrepancy was sent to Samsung Medical Center. The proband was identified to have an A2B phenotype by serological method. RBCs of the proband showed strong agglutination reactions with anti-A and anti-B reagents (Ortho Clinical Diagnostics, Raritan, NJ, USA), but no reaction with anti-A1 lectin (Ortho Clinical Diagnostics). Anti- A1 antibody was detected in the plasma (Table 1). Sequence analysis of exons 6 and 7 of the ABO gene was performed according to the previously described method [1], and revealed a heterozygous sequence (C and G) at nucleotide 803. Allele specific polymerase chain reaction (AS-PCR) for allele separation was subsequently carried out for two sequences. AS-PCR with sequence covering the c.261 to c.803 was performed as previously described [7] and of sequence covering the c.803 to c.1096 was performed using primer pairs 803G-F (GGCGATTTCTACTACCTGGGCGG) and ABO+19915AS (GGCGTATCTGCGATTGCGTGT) [8]. The proband harbored a rare c.803C>G substitution (p. Ala268Gly) in the ABO*B.01 allele (Fig. 1). This variant is annotated as ABO*cisAB.05 and ABO*BA.06 in the International Society of Blood Transfusion (ISBT) database [9].

Comparison of the serological results of cis-AB05, B(A)06, and proband

Forward typing Reverse typing Ref


Anti-A Anti-A1 Anti-B Anti-A,B Anti-H A1 cell B cell


monoclonal polyclonal monoclonal polyclonal
ABO*BA.06/ *O.01.01 4+ 4+ 4+ 4+ 4+ 2+ [4]
ABO*cisAB.05/*O.01.01 4+ 4+ 4+ 4+ 4+ 4+ [14]
ABO*cisAB.05 or *BA.06/*B.01 4+ NT 4+ NT NT NT 3+ In this case

Fig. 1. (A) Genetic characterization of cis-AB and B(A) alleles (in exons 6 and 7 of the ABO gene). The black and white boxes indicate the A and B backbones, respectively. (B) Sequencing chromatograms of a proband with nucleotide substitutions at position 803. The left chromatogram reveals a heterozygous sequence (C and G) at c.803. The two right chromatograms reveal the ABO*cisAB.05 or ABO*BA.06 allele and ABO*B.01 allele.
Discussion

To date, several weak ABO subgroups have been discovered in various populations. Although ABO subgroups are rare, they are a leading cause of ABO discrepancy [10]. In most cases, weak phenotypes result from the expression of a variant ABO allele, which can be revealed by molecular genetic analysis, thereby resolving the ABO discrepancy. Cho et al. reported their results with the resolution of ABO discrepancies by ABO genotyping [11]. In this study, serological analysis revealed ABO discrepancy with A2B phenotype and the presence of anti-A in patient’s serum. It was speculated that the underlying genotype of the A2B phenotype could be cis-AB/B, B(A)/B, B(A)/O, or A2/B [12,13]. Interestingly, the ABO genotyping demonstrated that the proband harbored the c.803C>G variant (p.Ala268Gly) in the wild type B allele (ABO*B.01), which corresponded to ABO*cisAB.05 or ABO*BA.06 allele. In this study, we tried to distinguish whether this allele is ABO* cisAB.05 or ABO*BA.06. However, the distinction between the two alleles is inherently infeasible, as the nucleotide sequences of the two alleles registered in the ISBT database (only covering exons 6 and 7) are identical. The regions outside of exons 6 and 7 have not been previously reported and further studies are needed to determine the nucleotide sequences in ABO exons 1∼5 and the flanking regions of the two alleles. In fact, the distinction between the two alleles has no clinical implication.

The ABO*cisAB.05 and ABO*BA.06 alleles have been reported only in one Chinese subject with an A2B phenotype [4,14]. However, B(A) blood group types and ABO*cisAB.05 allele have never been confirmed by molecular analysis, although other alleles of cis-AB blood group, such as ABO*cisAB.01 and ABO*cisAB.04, have been reported in Korean and Japanese populations [12]. In Chinese population, B(A) is more abundant than cis-AB blood group [13]. Among B(A) alleles, ABO*BA.04 is the most common (Table 2).

Estimated cis-AB and B(A) frequency in the Asian population

Allele Frequency(*10–5) Ref

China Japan Korea
B(A)02 0.78 N/A N/A [13]
B(A)04 1.6 N/A N/A [13]
B(A)06 0.3 N/A N/A [13]
cisAB01 0.66 1.2 35.4 [12]
cisAB05 N/A N/A N/A

Abbreviation: N/A, not applicable.



The possibility of ABO*cisAB.05 and ABO*BA.06 alleles being identical has been noted as the nucleotide changes reported for both alleles are the same based on dbRBC, and the ABO*cisAB.05 allele has been accepted in dbRBC without publication or GenBank submission [15]. In addition, unlike the common B(A) phenotypes with ABO*BA.04 allele, ABO* BA.06 phenotype tends to show strong positive reaction with monoclonal anti-A reagent, which is the same as in ABO*cisAB.05. However, in reactions with human polyclonal anti-A reagent (ShuBao, Chengdu, China), RBCs with the ABO*cisAB.05 phenotype are agglutinated, while RBCs with the ABO*BA.06 phenotype are not agglutinated [14]. With the advent of potent monoclonal anti-A reagents, human polyclonal anti-A reagents are no longer frequently used as a routine serologic test. Unfortunately, further distinction between ABO*cisAB.05 and ABO*BA.06 was not feasible, due to lack of sample.

This is the first case of a Cambodian individual residing in Korea with this ABO subgroup variant. From demographic perspective, foreign residents accounted for 4.57% of total Korean population in 2018 [16]. As the number of foreign residents in Korea continues to grow annually, the need to understand rare blood groups found in other ethnicities as well as in Korean population increases.

요 약

Cis-AB와 B(A)는 A와 B의 당전이효소 활성을 동시에 함께 갖는 효소를 부호화하는 특징이 있다. cis-AB 표현형은 드물지만 한국인, 일본인 및 중국인 인구에서 일반적으로 발견된다. B(A) 혈액형의 사례는 이전에 보고되었지만 대부분 중국 인구에 국한되어 있다. ABO 불일치를 가진 캄보디아 여성의 혈구형 검사에서 항-A, 항-B시약에 강한 응집을 보였고 항-A1 렉틴에서는 응집을 보이지 않았다. 혈청형 검사에서 A1 적혈구에 응집을 보였다. ABO 유전자의 엑손 6과 7 분석에서 ABO*B.01 대립유전자를 동반하는 c.803C>G 변이를 가진 ABO*cis-AB.05 혹은 ABO*BA.06를 보유하는 것으로 밝혀졌다. 일반 혈청학적 검사와 ABO 유전자 검사를 했음에도 ABO*cis-AB.05ABO*BA.06를 정확히 규명할 수는 없었다. 그럼에도 이 돌연변이들은 국내에서 처음 발견되어 보고하는 바이다.

References
  1. Cho D, Kim SH, Jeon MJ, Choi KL, Kee SJ, Shin MG, et al. The serological and genetic basis of the cis-AB blood group in Korea. Vox Sang 2004;87:41-3.
    Pubmed CrossRef
  2. Cho D, Kim SH, Ki CS, Choi KL, Cho YG, Song JW, et al. A novel B(var) allele (547 G>A) demonstrates differential expression depending on the co-inherited ABO allele. Vox Sang 2004;87:187-9.
    Pubmed CrossRef
  3. Cho D, Shin MG, Yazer MH, Kee SJ, Shin JH, Suh SP, et al. The genetic and phenotypic basis of blood group A subtypes in Koreans. Transfus Med 2005;15:329-34.
    Pubmed CrossRef
  4. Deng ZH, Yu Q, Liang YL, Wang DM, Su YQ, Wu GG. Characterization of a novel B(A) allele with BBBA type at the ABO blood group. J Hum Genet 2006;51:732-6.
    Pubmed CrossRef
  5. Lee SY, Phan MT, Shin DJ, Shin MG, Park JT, Shin JW, et al. A novel cis-AB variant allele arising from a de novo nucleotide substitution c.796A>G (p.M266V) in the B glycosyltransferase gene. Transfus Med 2015;25:333-6.
    Pubmed CrossRef
  6. Yoon J, Youk HJ, Chang JH, Jang MA, Choi JH, Nam MH, et al. Identification of the ABO* cis-AB04 allele with a unique substitution C796A: the first case in Korea. Ann Lab Med 2016;36:620-2.
    Pubmed KoreaMed CrossRef
  7. Cho D, Jeon MJ, Oh BJ, Song JW, Shin MG, Shin JH, et al. A simplified ABO genotyping by allele-specific polymerase chain reaction. Korean J Lab Med 2005;25:123-8.
  8. Sano R, Nakajima T, Takahashi K, Kubo R, Kominato Y, Tsukada J, et al. Expression of ABO blood-group genes is dependent upon an erythroid cell-specific regulatory element that is deleted in persons with the B(m) phenotype. Blood 2012;119:5301-10.
    Pubmed CrossRef
  9. International Society of Blood Transfusion (ISBT). Names for ABO (ISBT 001) blood group alleles. https://www.isbtweb.org/fileadmin/user_upload/Working_parties/WP_on_Red_Cell_Immunogenetics_and/001_ABO_Alleles_v1.2.pdf [Online] (last visited on 19 April 2020).
  10. Huang H, Jin S, Liu X, Wang Z, Lu Q, Fan L, et al. Molecular genetic analysis of weak ABO subgroups in the Chinese population reveals ten novel ABO subgroup alleles. Blood Transfus 2019;17:217-22.
    Pubmed KoreaMed CrossRef
  11. Cho D, Lee JS, Park JY, Jeon MJ, Song JW, Kim SH, et al. Resolution of ABO discrepancies by ABO genotyping. Korean J Lab Med 2006;26:107-13.
    Pubmed CrossRef
  12. Chun S, Choi S, Yu H, Cho D. Cis-AB, the blood group of many faces, is a conundrum to the novice eye. Ann Lab Med 2019;39:115-20.
    Pubmed KoreaMed CrossRef
  13. Zhu Z, Ye L, Li Q, Gao H, Tan Y, Cai W. Red cell immunohematology research conducted in China. Transfus Med Rev 2017;31:102-6.
    Pubmed CrossRef
  14. Deng ZH, Seltsam A, Ye YW, Yu Q, Li Q, Su YQ, et al. Haemolytic disease of fetus and newborn caused by ABO antibodies in a cisAB offspring. Transfus Apher Sci 2008;39:123-8.
    Pubmed CrossRef
  15. Reid MR, Lomas-Francis C, Olsson ML. The Blood Group Antigen FactsBook. 3th ed. Amsterdam: Elsevier Academic Press, 2012.
    CrossRef
  16. Korea immigration service (Korea). 2018 Korea immigration service statistics annual report. http://www.moj.go.kr/moj/2412/subview.do [Online] (last visited on 19 April 2020).

 

December 2020, 31 (3)
Full Text(PDF) Free

Social Network Service

Cited By Articles
  • CrossRef (0)

Author ORCID Information
Services