search for




 

ABO*B3.01 Found in the A1B3 Phenotype Showing ABO Discrepancy: The First Case in Korea
ABO 불일치를 보인 A1B3 표현형의 ABO*B3.01 유전형 1예: 국내 첫 보고
Korean J Blood Transfus 2019;30:236−240
Published online December 31, 2019;  https://doi.org/10.17945/kjbt.2019.30.3.236
© 2019 The Korean Society of Blood Transfusion.

Namsu Kim1, HongBi Yu2, Jaehyeon Lee1,3, Dal Sik Kim1,3, Hye Soo Lee1,3, Yoo Na Chung4, Yong Gon Cho1,3, Duck Cho2,4
김남수1ㆍ유홍비2ㆍ이재현1,3ㆍ김달식1,3ㆍ이혜수1,3ㆍ정유나4ㆍ조용곤1,3ㆍ조 덕2,4

Department of Laboratory Medicine, Jeonbuk National University Medical School1, Jeonju, Department of Health Sciences and Technology, SAIHST, Sungkyunkwan University2, Seoul, Research Institute of Clinical Medicine of Jeonbuk National University-Biomedical Research Institute of Jeonbuk National University Hospital3, Jeonju, Department of Laboratory Medicine and Genetics, Samsung Medical Center, Sungkyunkwan University School of Medicine4, Seoul, Korea
Yong Gon Cho
Department of Laboratory Medicine, Jeonbuk National University Medical School, 20 Geonji-ro, Deokjin-gu, Jeonju 54907, Korea
Tel: 82-63-250-2388, Fax: 82-63-250-1200, E-mail: choyg@jbnu.ac.kr, ORCID: https://orcid.org/0000-0003-3011-6875
Received July 12, 2019; Revised July 17, 2019; Accepted July 24, 2019.
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract

B3 is a rare finding, but it is most common in the B subgroup, which been reported as being 0.025% of the total B group in Koreans. ABO*B3.01 is a specific allele for B3, a missense mutation with a substituted thymine from cytosine of the 1,054th nucleotide of the ABO*B.01 allele, but rather unexpectedly, it has not been reported in Koreans. We report here the first Korean case of the serological A1B3 phenotype with ABO*B3.01, which was confirmed by sequencing of exons 6 and 7 of the ABO gene, found in a pregnant woman.

Keywords : B subgroup, B3, ABO*B3.01, ABO genotyping, ABO discrepancy
서 론

최근 ABO 혈액형 유전자에 대한 분자유전학적 검사가 국내에서 보편적으로 시행됨에 따라 A 또는 B의 아형을 결정하는 대립유전자가 보고되고 있다. B3 표현형은 가장 흔한 B의 아형으로 그 빈도는 한국인 B형 중 0.025%로 보고되어 프랑스(0.01%)보다는 높고, 중국(0.11%)보다는 낮은 것으로 알려졌다[1]. B3의 표현형을 결정하는 특이대립유전자는 현재까지 8종류가 보고되었으며[2-5], 이 가운데 ABO*B3.01ABO*B.01 대립유전자의 1,054번째 뉴클레오타이드인 사이토신이 티민으로 치환되는 과오 돌연변이(missense mutation)로 B3형 중 가장 먼저 등록 되었다. 그간 B3.01 대립유전자의 빈도는 정확히 보고되지 않았다. B3.01은 B3의 대표적인 대립유전자로 알려졌기 때문에 한국에서도 이들 대립유전자가 흔히 발견될 것으로 예측되었지만, 예상과 달리 보고된 적이 없었다. 다만, 한국인에서는 ABO*B3.05 [6], ABO*B3.06 [2], ABO*BW.03 [1]가 보고되었다. 이에 저자들은 ABO 혈액형 검사에서 ABO 불일치를 보인 산모로부터 발견된 B301 대립유전자를 국내의 문헌고찰과 함께 보고하고자 한다.

증 례

29세의 여자 환자가 임신 36주 상태로 제왕절개술에 의한 분만을 위해 내원하여 시행한 통상의 ABO 혈액형 검사에서 ABO 불일치 소견이 관찰되어, 이를 해결하기 위해서 추가로 혈청학적 검사 및 ABO 유전자 검사를 시행하였다. 환자는 타 의료기관에서 이미 제왕절개술에 의해 2명의 아이를 정상적으로 분만하였고, 과거 시행한 혈액형 검사 결과혈액형이 불분명하다는 소견이 있었다.

1. ABO 혈청학적 검사

환자의 ABO 혈액형 검사는 IH-500 (Bio-rad, 1785 Cressier FR, Switzerland) 장비를 이용하여 제조사의 지침에 따라 시행하였다. 추가로 DiaClon ABO/D+ Reverse Grouping ID Card (Bio-rad)를 활용하여 수기법으로 시행하였는데, 모두 ABO 불일치 소견이 관찰되었으며, 또한 장비간의 혈구 응집강도도 확인되었다. 즉, 혈구형에서 anti-B의 응집 강도가 자동화 장비에서는 2+, 수기법은 trace (±) 반응이었고, 혈청형에서는 B cell의 응집강도가 자동화 장비에서는 trace (±) 반응이었고, 수기법에서는 음성을 보였다(Fig 1A, 1B). 함께 시행한 항-A1 반응은 양성이었으나, 항체선별검사와 자가대조 및 연전현상 확인검사는 모두 음성이었다. 이러한 결과는 cis-AB 혈액형과 감별이 필요하였다.

Fig. 1.

Serologic results of ABO typing (A) by IH-500, and (B) by manual microcolumn agglutination tests.


2. ABO 유전자 검사

환자의 EDTA 전혈에서 채취한 DNA를 원 등이 보고한 방법[7]과 동일하게 ABO 유전자의 엑손 6과 7을 직접염기서열 분석한 결과 ABO*A1.02/ B3.01의 유전자형(Table 1)을 확인하였고, 환자의 B3 표현형은 ABO*B3.01 대립유전자에 의해 생성되었음을 알 수 있었다.

Results of ABO genotyping identical to the ABO*A1.01/B3.01

SiteExon67



cDNA261297467526564579641646657669681703721771796802803805829871930105410611096
ABO*A1.01GACCCTTTCGGGCCCGGTGGGCCG
ABO*B.01-G-G----T--A--A-C---A---
ABO*A1.02--T---------------------
ABO*B3.01-G-G----T--A--A-C---AT--

3. B항원 약화의 in silico 분석

c.1054C>T (p.R352W) 변이가 적혈구 B항원의 표현형에 미치는 영향을 분석하기 위하여 아미노산 변이가 단백질에 어떠한 변화를 유발하였는지 예측하는 생물정보학 분석프로그램인 PolyPhen-2 (http://genetics.bwh.harvard.edu/pph2/)와 SIFT (http://sift.jcvi.org/www/SIFT_enst_submit.html)를 시행하였다. 그 결과 PolyPhen-2에서는 “Probably damaging”, SIFT에서는 “Damaging”으로 단백질 구조에 변성을 일으킬 가능성이 높을 것으로 예측되었다.

고 찰

ABO 불일치가 발견되면 그 원인을 규명해야 한다. 본 증례에서는 자동화장비(IH-500)에서 실시한 ABO 혈액형 검사에서 혈구형에서는 A1Bweak (anti-B: 2+), 혈청형에서는 B cell에 trace 양성을 보였다. 이에 추가로 동일 회사 시약으로 수기법 재검을 실시하였는데, 혈구형은 A1Bweak (anti-B: trace), 혈청형에서는 B cell에 음성 소견으로 다른 결과를 보였다. 이처럼 동일한 시약으로 시행한 ABO 검사 결과의 불일치는 자동화 장비와 수기법의 incubation 온도는 비슷하지만 자동화 장비 내에서 보관되는 시약의 온도가 13∼16°C로 수기법과 달라 발생하는 것으로 추정되었다.

일반적으로 A1B3가 관찰되면 cis-A1B3형과 감별이 중요하다. 주요 감별점은 혈청형에서 B cell에 응집을 보이면 cis-A1B3를 의심하고, B cell에 응집이 없으면 일반적인 (trans) A1B3를 더 의심할 수 있으며 수혈은 혈장과 혈소판은 모두 AB형이 추천되지만, 적혈구의 경우는 cis-AB형인 경우는 적혈구의 경우 O형이나 A형이 추천되고, 일반 AB형은 어떤 혈액형도 가능하지만 혈소판과 혈장과 동일하게 AB형이 추천되기도 한다[8]. 따라서, 본 증례는 정확한 혈액형을 규명하기 위해서 ABO 유전자 검사를 시행하였다.

유전자 검사 결과 ABO*A1.02/B3.01이 규명되어, 환자의 B3 표현형은 ABO*B3.01 대립유전자에 의해 생성되었을 것으로 추정할 수 있었다. ABO 혈액형은 인종 간 차이를 보이며 B형과 B의 아형은 미국이나 유럽 백인에 비해 한국인, 일본인, 중국인 등 동양인에 상대적으로 많이 분포하는 것으로 알려져 있고, 실제 B3 특이대립유전자들도 대부분 한국과 일본, 중국인으로부터 규명되었다. 최근까지 ISBT에서 명명한 ABO 혈액형 대립유전자 데이터베이스(Names for ABO (ISBT 001) Blood Group Alleles)에 등록된 B3형에 대한 특이대립유전자는 총 8개로[2-5], ABO*B3.01 (c. 1054C>T), ABO*B3.02 (c,646T>A), ABO*B3.03 (IVS3+5G>A), ABO*B3.04 (c.247G>A), ABO* B3.05 (c.425T>C), ABO*B3.06 (c.547G>A), ABO* B3.07 (c.410C>T), ABO*B3.08 (c.938A>C)이다. 대부분의 대립유전자는 ABO 유전자의 엑손 6과 7의 분석을 통해 규명되었고, 이 등은 국내 B3형에 대한 유전자 분석을 엑손 6과 7 뿐 아니라 엑손 1-5도 추가로 직접염기서열 분석을 시행하였으나, ABO*BW.03을 제외하고는 대부분 ABO*B.01이 관찰되어 B3 표현형을 설명할 수 있는 합당한 대립유전자는 발견되지 않았다. 그런데, B3형과 달리 A1B3형은 ABO*A/cisAB.01, ABO*A/B3.06등이 원인 유전자로 규명되었다[8,9]. 그런데, B3 표현형을 결정하는 대립유전자로 가장 먼저 명명된 ABO*B3.01은 예상과 달리 그간 한국인에서 보고된 바가 없다.

ABO*B3.01이 Yamamoto 등[4]에 의해 A1B3 표현형을 가진 일본인으로부터 처음 규명되어 B3 표현형을 결정하는 특이대립유전자로 알려졌지만, 일본 내에서 조사된 연구[3]에서 보고되지 않았고, 중국인을 대상으로 한 연구[10]에서도 보고되지 않아 B형과 그 아형이 상대적으로 많이 분포하는 것으로 알려진 동양인 가운데에서 ABO* B3.01은 매우 드물 것으로 보인다. 다만, 대부분의 조사나 연구가 제한된 수의 B3나 A1B3 표현형을 대상으로 시행되어 ABO*B3.01의 분포에 대한 정확한 빈도가 알려지지 않아 추가 연구가 필요하다고 생각된다.

ABO*B3.01은 B3 표현형을 결정하는 대립유전자로 알려졌다. 이를 규명하기 위해서는 발현검사를 실시할 수 있다. Cho 등[6]은 O형을 가진 환자에서 유래한 HeLa 암세포주에 ABO*B.01 유전자, ABO*BW.01 유전자, 그리고 ABO*B3.05 대립유전자를 각각 삽입하여 세포주에 발현된 B항원을 유세포 분석으로 정량적으로 비교하면서, ABO* B3.05 유전자가 B3 표현형을 유발하였음을 실험적으로 증명하였다. 하지만, 이러한 발현 검사는 많은 노동력과 시간이 소요되어 최근에는 간접적인 방법이지만 보다 간편한 in silico 분석을 실시할 수 있다. 약한 D 표현형을 보인 여자 환자에서 규명된 RHD*01W.33가 적혈구 D항원의 표현형에 미치는 영향을 규명하기 위해 PolyPhen-2와 SIFT로 D 단백질 구조에 변성을 분석하여 표현형에 영향을 유발할 가능성이 높을 것으로 예측된 보고가 있다[11]. 본 연구에서도 B301 대립유전자를 in silico 분석하였고, damaging이 있음을 확인하여 Yamamoto [4]가 규명한 것을 다시 확인할 수 있었다.

요 약

B3은 드물지만 B 아형 중에서 가장 흔하며, 한국인 전체 B형의 0.025%로 보고되었다. ABO*B3.01ABO*B.01 대립유전자의 1,054번째 뉴클레오타이드의 시토신이 티민으로 치환된 과오변이이며, B3에 특이적인 대립유전자이지만 예상외로 한국에서는 거의 보고되지 않았다. 저자들은 A1B3 임산부에서 발견된 ABO*B3.01을 ABO 유전자의 6번과 7번 엑손의 직접염기서열 분석을 통해 확인하였고 한국인 첫 증례를 보고한다.

References
  1. Lee S, Cho D, Jeon M, Song JW, Shin MG, Shin JH et al. Analysis of complete exons and flanking introns of ABO gene in Korean B3 blood donors. Korean J Blood Transfus 2006;17:97-105.
  2. Cho D, Kim SH, Ki CS, Choi KL, Cho YG, Song JW et al. A novel B(var) allele (547 G>A) demonstrates differential expression depending on the co-inherited ABO allele. Vox Sang 2004;87:187-9.
    Pubmed CrossRef
  3. Ogasawara K, Yabe R, Uchikawa M, Nakata K, Watanabe J, Takahashi Y et al. R Recombination and gene conversion-like events may contribute to ABO gene diversity causing various phenotypes. Immunogenetics 2001;53:190-9.
    Pubmed CrossRef
  4. Yamamoto F, McNeill PD, Yamamoto M, Hakomori S, Harris T, Judd WJ et al. Molecular genetic analysis of the ABO blood group system:1 Weak subgroups:A3 and B3 alleles. Vox Sang 1993;64:116-9.
    Pubmed CrossRef
  5. Yu LC, Twu YC, Chou ML, Chang CY, Wu CY, Lin M. Molecular genetic analysis for the B(3) allele. Blood 2002;100:1490-2.
    Pubmed CrossRef
  6. Cho D, Shin DJ, Yazer MH, Ihm CH, Hur YM, Kee SJ et al. The M142T mutation causes B3 phenotype:three cases and an in vitro expression study. Korean J Lab Med 2010;30:65-9.
    Pubmed CrossRef
  7. Won EJ, Cho D, Heo MS, Park HR, Shin MG, Ryang DW. Six years'experience performing ABO genotyping by PCR-direct sequencing. Korean J Blood Transfus 2012;23:236-47.
  8. Chun S, Choi S, Yu H, Cho D. Cis-AB, the blood group of many faces, is a conundrum to the novice eye. Ann Lab Med 2019;39:115-20.
    Pubmed KoreaMed CrossRef
  9. Seo D, Kim S, Kim JY, Park S, Lee JB, Han KS. Molecular characteristics of B subgroups in Koreans. Korean J Lab Med 2005;25:280-4.
  10. Cai X, Jin S, Liu X, Fan L, Lu Q, Wang J et al. Molecular genetic analysis of ABO blood group variations reveals 29 novel ABO subgroup alleles. Transfusion 2013;53 11 Suppl 2:2910-6.
    Pubmed CrossRef
  11. Yu H, Park JE, Park G, Cho D. Weak D type 33 found in a patient with a weak D phenotype:the first case in Korea. Korean J Blood Transfus 2019;30:65-70.
    CrossRef

 

December 2019, 30 (3)
Full Text(PDF) Free

Social Network Service

Cited By Articles
  • CrossRef (0)

Author ORCID Information
Services