The Korean Journal of Blood Transfusion : eISSN 2383-6881 / pISSN 1226-9336

Table. 1.

Table. 1.

Laboratory developed nested PCR primer set for HTLV and GAPDH

TargetPrimer   Sequence (5’→3’)Amplicon size (bp)
pXExternalpX1AGGGTTTGGACAGAGTCTT230
pX2AAGGACCTTGAGGGTCTTAG
InternalpX3CTTTTCGGATACCCAGTCYAC
pX4GGTTCTCTGGGTGGGGAAGGAG
GAPDHExternalGAP1AAATCAAGTGGGGCGATGCT350
GAP2GAAAGGTGGGAGCCTCAGTC
InternalGAP3AGGACCCGGGTTCATAACTG
GAP4TCCCATTCCCCAGCTCTCATA
Korean J Blood Transfus 2019;30:57-64 https://doi.org/10.17945/kjbt.2019.30.1.57
© 2019 Korean J Blood Transfus